Echinops_telfairi Locus TCP1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi TCP1
Echinops_telfairi
TCP1
GeneScaffold_2822
SNORA29, SNORA29, SNORA20
2737..2879, 4003..4141, 6865..6990
9277
TGGTAGATGTATACATATATATAAATGATCAAACCTATATACATTATATATAATGATTA
AACTCTTCCTCTTCACGCGGTGTGGCTGAAATTGGTTTTTTGCGTCGCCCCTAGCAAGAC
CCCACATTAGGTTAAAGGATCCCCAAAAGGCACTGGGAGGAAATCGGACATGGCAAGATA
AATCTTTCAGAACGGGGGGTTGTCTTCCTAGAAACAGTTTCTCCCACAGAGCTCAGGAAA
GAAAGCATCGGTGGGGACCCGGTCCATCCTCGGGAGCTCCAGCCAATTACCCGGCGCTCC
CTGAGCATCTTCGATTGGAAGAAGACGCAGAAATGGTTTAAAGCTAAACCGTGGGGTATG
CTCAGATCCAGGGAGAAAAAGTGGCTTCCTAGTTCCTTAAAGTAGGATCCCATACCGGCA
GCTCTACCCTGTCCTCTGGGGTCTCTGTGCAAAGGAACGACCCCAGGGCGGCGAGCTTTC
TTGGAGTTTGGCTGAGAATCCCAGGCAGGTTTAGAAGAGGACCTGCTCGTCACCACACCC
CTCCCCCGCCTCAAACCGCCCCAGACCCCGCCCCGCGGACCCGCTTTTCTAGAAGTCACT
GGAACGTCTCAACTCGCATGCGCATCGTGCCCGGGGGTGGGCGGGGGCGACCGCTCGCCC
ACGCGCCTCCTTTCTCCAGAAGCCCTTGCCCCTGACGTCCGCTCGCCGCGCTTCGCGCCC
TTCTCATCCGCACTCTAATTGGGCAAATGTACCGGCACGCCTCTGAGCCCACCCTCTTCT
GCTCGTCACTTCCGGCGGCTTCGGGCTTCTCTTCTCCCATCCTGCCCCGCGGTCGTCGGG
CTCGGGGAGGGGTCAGCGAGGCCCGCGGTGTTACCCAGCAGCCCCCGCGACGTCGCTCGG
CCCGCTCCACGCCGTCGCCGCTGCCGCTGCCTTGTGTAGGGAGGGAGCAGACCCGGTGGC
CCGCGGTGTGAGCGGAATTTATCGTGTCTCTCGCCGCGAAGATGGAGGGGCCTTTGTCTG
TGTTCGGGGACCGCAGCACCGGGGAGGCGATCCGCTCCCAGAACGGTAAGGGCGGAGAGG
CCTGGTCCGCCCCATGGTCACCCTCTTGGCATCTGTTCACCACAAAGAGCCCCCGGAGCC
TCGCCGGCCGTTTTCCGCTTCTGGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGATCCCG
GCGCGGAGGGTCTTAGCGCAGCACGTGAGCGCCGCGCCGGCTGGACGTGGAGCCGGGCCG
CGCGCCGCCGTCGCCCGGGAGCGGTAGGGGGGCGCGGTGGTTCTCGGGTGCACGGGCGCC
GGCGCCGAGGTCTAGATGCAGTGCTGCCCTGTGCTAACTGACCGCTTACCCTTGATAGAA
CGGGCCGGTGACGGCGCAGTGCAATAAGTAGTAGGTTCTTCTCAAGGTAGGACGGAACGC
GATTCGTACCTGAAGCCTGGTTGCTGTTACTGAGCTTCGCTTTGAAAGCCTTTTGTAGAT
TTTCTAGTACTTGGGCGAATTTTGACATAAAGGCAGCGCATCTTGTCACTCTGTTACTGC
ATTTTCAGTTCCTGGTAAAGAGCTACTGTAATGGTTTGTGGGTTTTTTGTTAATTGCTTT
AAATAAAAAATGTACTTTGCACAGACCACGCCCTAAAACAGGCTTTTAACTTACTGAGGG
GAGATTTGTGTAAATTGAAATCCTAGAGATTGGAAGCTCAATTTAAGCTGCCCTGGTGGC
AGTAGTGGGGCTACTAAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCGTAAAGAAAGAATAGGGCTTAAACCATAGCTATTTAA
ATGGTTTCTTACCAGAACCGTGGTATTTGAAGACTAATGATGATGGTGTGCCTGATGGGG
TTAGGTTGATTGCAGGATGTGTTTCTGAGAGTGATTTCTGTTGTCTACCTTACAATTTTC
TTAGGATGTAACCATTACTAATGATGGTGCGACCATTTTGAAGTTACTGGAGGTAGAACA
CCCTGCAGCGAAGGTGCTTTGTGAGCTGGCTGATCTTCAAGACAAAGAAGTTGGAGATGG
AACTACTTCAGTGGTAGGTCCACTTTGCAAAGTTTGACAATTCATACAGCACAGGAGTTT
CTTCCTGTAGTCAGTCCCCCTGCCTTGTCTTTTTTGTTTTCCCATTTGACTACTGCTTCA
GATCTTACTAATAGATTGAAGTGGTTATGCTTGTGGGATAGATTAACATTGCCATGATCT
GAAGAGGGAGGATTATTTTTTAATGTCCTCCCCCTATATGAAATGGCTGTACATTTATAT
AAACCTTGCCTTTACAATTGTGTGTGGGAGGTGTTATTTTGTTAAGCATATTTTAGAAGT
TGACAATCAAGAATTCCTTATAGAAATGTGAGAAAGTGATTTGCTGTGTGACTAATGAGT
GGGAAAATCAGTGAATATCCCGAGGTAATTTAAACTCAAAACATCCAACACACTGAAGTA
GAAACACTTGTATGTTGAGTACAGCGATGATTCCAGCCAAAAAGGTGGTGGCACTGGTGG
TGTAGGGCATATTTATGGATTAACATTCAGCCTTGAAGGAATGGCTTCTCCTAGATTAAT
GTAACTGGCCTTTTGTCTTGGTAATTTGTTTTATGACCTGTCGAGCAAATAATAGTTTCC
CAAAATTGAAGTCGTTTCGTTTTAATTTTCATAAACTAGTGAAAACCAGTTGGCATCAAG
TTGATTCATAGTTGCAGTGACCCGATAGAATATTTAAATATATATACATATACATATATT
TAATTTTTTAGGAAGTATATATTCTGAAGGGCATTTATGTGTGGCTGAAGTACTAGTCTT
TTGATTTGAATGAGCTAACCATTTGTGCCACCCACAGACATTTAGTATTCTGAAAGAAGA
ACTGAAGTGAGTCCAAAACCAGATCCTAGAATTGGGTAGAGAATTTGAGTAATCAAACTC
TGGATTTAACTTCTGTTGGGTATTTAATTTATGTAATGGGTATATAGTCCTAGTATTGTT
CCTGCTGAACTAATTTCTTAGCCAGAACAATATTCTGGCTCCTAATTCTTGGCATTGCGG
AGTATGAAACACAGTGTAGAGTTTTATACCCTATCAGTTTTGTTTATTCACCATTGTGGT
TAATGTGTGCTTGCTTTAGTGTTGTTTTTACATACGCATAATACATACTAAACATTGTCA
GACTTCAGAGCTTTAACTGTTCAATGTTTTCTCAACAGGTTATTATTGCAGCAGAACTTC
TAAAAAATGCAGATGAACTAGTCAAACAGAAAATCCATCCCACATCAGTTATTAGTGGCT
ATCGACTTGCTTGCAAGTAAGATTGTTATTTGATGTAATCATAAAGACATTGCTTTTAAA
TTTGATGGGAAAGAGCTGAAGTTTTAGTGTTCAGACCAGTATCGTTCCCATGTGACTACC
ACTTCAACTCTTAATAATAGATTGTAGTGGCTATGCTTGTGGGATAGAGTGATTTTTGCC
ATGATCTGAAGAGGGAGGTTTATTGTGTCCTCCTCCTATATGAAATGGCTGTACAGAAAA
TGAAGACTCATTATTTTGGTACTGTGTGCAATTTGATAGACAGTTTTGAAGTGTTGAGCA
GTGGGCCTGTTTTCTCACTCGTGCCTTTAACAGGGAAGCTGTGCGTTATATCAGTGAAAA
CCTCATTATCAACACAGATGAACTTGGAAGAGATTGCCTAATTAATGCTGCTAAGACATC
CATGTCCTCCAAAATCATTGGAATGTATCCTTGTGGGTAGTACAATAAAGTAGCCTTTTT
CAAAAAGTAAGAGCTTAGGTTTTTATCCTTGGATGATGATTATTGCTATTGCCTTACAGA
TAATATTGTGTTGAAATTATGGGGGAGGGGTTACAGTGATAAAATTTAATATGTTGATAT
TCCTGCAGTATTTTGTTAACCTAAATGCTGGTGTGGGGGTTGATTTTTCTTTGATGAATG
GAATTGCTAAAAGGGCATCCTTTTGAATTACTCATTCATTTTTATGTATAATTTGTCTAT
TCCACGTGTTATCATCCTTAAATGTTGGCTTAGAAACGGTGATTTCTTTGCTAATATGGT
GGTGGATGCCGTACTTGCTGTTAAATACACAGATGGAAGAGGCCAACCTCGATACCCAAT
CAATTCTGTTAATATTTTGAAAGCCCATGGAAGAAGTCAAATGGAGAGTCTGCTCATCAG
TGGCTATGCTCTGAACTGTGTAGTGGGATCCCAGGGTAAGAGTTGGGCTTGGGTCATGTA
ATGGGGATGGGGGACCACAGGTTAAATTGAACTTTTTGTGGGCGGTCTACTGTATCTTTA
CAGATGAACTACCCAAGATGTGTGAGTGAACGGCTCTTAAATGAGACGGCAGAGGGGTGC
ATTAATCACTTAGTTTCTAGTAATTTAAGCATGCAACTTACAATGAATTACCTTTAACAG
CATCTTTCATCCTGTGGCTCATGTAGCACAATTAAAGGCTTAATCTGTTTGTGTGTTATA
TGTGTATCAGTACTTCTCATTGTTTTGCTGCTAGGTGTTTTATATGAAACGTAGTGTTGT
TGGACTTGGCAGTGAGAAAACCTAATGCTGTGTTCAATTTCAGGCATGCCCAAGAGAATC
GTTAATGCAAAAATTGCTTGCCTTGACTTCAGCTTGCAAAAAACTAAAATGAAGCTGGGT
GTACAGGTGGTTATTACAGACCCAGAAAAACTGGACCAAATCAGACAAAGGTGGGTATAG
AAGTTCTTTTTAGCCTTTAAAGGGATTACTTATAAATTATACTTGTGTGTGAAAAGGACT
AACCATGACATTAAAACATAGATTCCCAAACTTAGTTGACCTACTGCCCCTTTTCAGAAA
GAAAAAAATACTATGATCCTAGATAAAGTACAGCCCTCTGGGACCTTCCAGCGCCCCCAC
TTGATAATGTAGCCCATGTTGGGAAACACTGCCGTAAACTGAAAAGAATGCTTGCTTTGT
TGAATAGACAATGGAGCCAGATAAGAAACAACTCTTCATTACGAAGTTGGTGGTGAAGTT
TATATCACAGACATGATCTGGGTTTTTGTGCCATCCATGAAAATGGTTTGGGGGTGAAAA
TTTGGGCTTATGTGTCTGTTGATCGTGAAGGCCAGGAGTTTGTATCTATCTAAGTACAGT
TCTTAGCTTGAGCCAGGGAGGGCTGATGTAACCTATCTTTGCTTTATAGAGAATCCGATA
TCACAAAGGAGAGAATTCAGAAGATCCTGGCGGCTGGGGCCAATGTTGTTTTAAGTACTG
GTGGCATTGATGATATGTGCCTTAAGTACTTTGTGGAGGCTGGTGCAATGGCAGTTCGAA
GAGTTTTGAAACGGGACCTTAAGCGCATCGCTAAAGCTTCCGGGGGTATGTGTTCCGCCA
GTGGCGCGTGTAATCCTTTATGCCGATACACTTAGTTGGGTGAAGGATCCTTTTTACGTT
AGGACATTGACACTAAGCAGCTTCATAAAAAATGTTTACGTTTTCTAGTGACATATGCAC
CATTTTTATTGGGAAAGGCTAATGGAATTTACTGGGAAATTTCATGGAGTTTGTTCACTA
AAATTGTCAAGATTCCATTTTATAAGGACAGCTGTGTACCTGAACATGATACCACTTTTA
ACATAGTGAAGTCTTCATAAGGAAGTTGTCTGAAGGAGCAAGGTTTACCGTTTTTGTAAT
CATCTTTGTAGCTACTGTTCTATCAACCCTGGCCAATCTGGAAGGTGAGGAAACTTTTGA
AGCTGTTATGTTGGGACAAGCTGAAGAGGTGGTACAGGAGAGAATTTGTGACGATGAACT
GATTTTAATCAAAAAGTAAGACCTGCTTTCTAAATTTATTAAAAATTTATAAATTGTGTC
CCTGGGGGTGGTGATGTAGGTCAGTCTGGACTGCTAACCACAAGTTTGTCAGTTGAAACC
AACCAGTAACGTCCTTCTATCAAAAATGAGACTTTCTACCCCCTTAACACAAGGTTTACA
GGACACCTCATTTTGATCCATTTCCTTAAAATTACAGGAGCCCTTTACATTAACGATAAC
AGATGGATATTCAAATTCATTATAAGTCTTTCAAGTTTTTTTATTAACGTGTCCATAGAG
ATGGTATATTAAAAATGTCCATAAACCTAGTGTTAAAGATTATGAGTTGTGTACTATTAA
GTTCTATTCTGCTCTATAGGTTTCTTGAGTTGCAATTAGTTTGATGGCACTAAGGTGTTT
TATATAAGGCTTCTGACATTGCCATTTTCCCATTGATTTGCTGCTATTGTCTGTCAGTGA
TATGAGCAGGTATACGCATGGAATAAAATGAGACCCTTGCAAATTGAGATGAAAATAATA
ATTTTCTCTCTTCTGCATGGCCTGGACATTGGCTTTGGTATATAGTATGTCTAACTTAAC
CATATATACTGGATTTAAAAAAAGTTTTACTGGGAATTAGTACATATACATAATTCTATA
TTTCAGTCACGGCAAGTAGAATTGTACAATTGCTACCACAGTGAGTTTAAATTGTTCACT
TTAAAATGGTTTATGTGACATTAATCTCAAATTTGTTGGGTTTTAAAAAAATCATTTGGG
GGCTATCATAGTAATCCATACAAATGTTGTATCAAGCACATCTGTACATATGTTGCTATC
GTTTTGTAAACATTTTCTTTTTGTTTGAGCCCTTGGTGTGCAGGATTTTTAAAGGGACAT
TTGCAGTGATATCCAAGTGTTAATTGTAGACTGTTGCTTATTTCTCCACAGCACGAAGGC
GCGCACGTCTGCATCCATTATCTTACGTGGGGCAAATGATTTCATGTGCGACGAGATGGA
GCGCTCCTTACATGATGCTCTCTGTGTCGTGAAGAGAGTTTTGGAGTCTAAGTCTGTGGT
TCCAGGTGGGGGTGCTGTCGAAGCGGCTCTTTCCATATACCTGGAAAACTACGCAACTAG
CATGGTAAGCACTGCACTCTCAAGCAGCGTTAGCATTTTCTTAGCCCTTTACTGAGACCT
TATTGCTACTGAGGGTTGAGATTCATTTTCCCTTCCTTTTTTCATCAAATTGTCTTTTCA
CGTAGGGGTCTCGGGAACAGCTCGCAATTGCAGAGTTTGCAAGATCTCTTCTTGTTATTC
CTAACACCCTTGCTGTTAATGCCGCCCAAGACTCTACAGACTTGGTTGCAAAGTTAAGAG
CTTTTCACAACGAGGCTCAAGTTAACCCAGAACGTAAAAACCTAAAATGGTAAGCATGTT
ATTTCCAAGTTATTTTCATCAACTGTATATTGTATGTGTTGAGGTGCATGATAGGTGTAA
CTAATAGAACAAATGAATACCTCTTCAGCTGTGTTGGTGGGTCTTTAACCCAACGCCCAG
TTCTGGTGATTCAAGACCTGGTGTGATTCTGTTAGCTTTTAAAGGCTGCTTTGTAAGAGG
CTGTTTTATTTTTAACTGCAGGATTGGTCTTGACTTGGTCAATGGAAAACCTCGCGACAA
CAAGCAAGCAGGGGTGTTTGAACCAACCATAGTTAAAGTCAAGAGTCTGAAATTTGCAAC
AGAAGCAGCGATCACCATTCTTCGGATTGATGATCTTATTAAATTACACCCAGAGAGTAA
AGATGATAAGCACGGAGGTTATGAAGATGCAGTTCACTCAGGAGCCCTTGATGGCTGATG
TGCTTTCTTTATTTATAAATTTGTTAGATGCACTGGTCAAGTATTAGGTTCACATTAAAA
TTATAATGCTGTCATGCCTTGGGTGGTTGTTGGATCTGTTTACACAGGTAGGTGAGGTTA
AAAACAAGTTTCATCCTCTCTGAACACACATTGCTATACCCATCCCCCCACCAATGCACA
GGGCAGCAACTCCACGCCGCCCACCGGTTCTCTCCAGGGTGTGTAACAGTGTCACAAGAA
TCCGACAACCAGATGCCCCAAGGGGGTGACCCAAGGCTATGGCCCCACCTTGGATGTTGA
TCTGTAGGGAAAGAGAACTTATTGGTTAATAGTCCTAAATTATTTCCTTCCACCTCTTTT
TTTTTAAAATCATTTTATTTCCTTCCACCTCTTAAGATAAAATCGGACCTTTATCTTAAA
TCTATAAGTAATTCAGAGTCTGGCATCCATTCCTGACTCTCCTTCCCTCAGAAACTTAAT
ACCTTGTGAATTTAGGAAGTGAGCTAACACAAAGGTTCACTACACCCCCAAGTTAGAGGA
ACATCAGTATTTAACTGATGGGGGTAAAATAAGTTCCATTTAAAGATGTTTTGCTATCTA
TAGTCAACTATAGTGTGAAAGTTGTAAGTCGCTCCTGTTTACCTTTTCTGGGCTTAATCC
CAGCTCTTTAGCTATTACTACAGAGAAGACTGCAAAGGCTTCATTGACTTCAAAGGTATC
AACATCCTCCAGTGACCAGCCAGCTTTCGAGACCTAAAGTAGATGGATGCAGTTATTGTA
AAAAAGAACAGTAAACATGGGCGCCTGATTCTCAAAAGATCTATTAAAACTGCAGCTTTA
GGTTGTGCAAACAGTCTGGTAATAACTCATTTTGCCTTGGTGACATCAATTTTGAACAAA
AGTTTATTTTGTTTTATTAGGGGCTCATACAACTTATCACAATCCATACATCAATTGTGT
AAAGCACATTTGTACATTAATTGCCCTCATCTTTCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1064, 2018..2103, 2524..2652, 3818..3915, 4233..4343, 4653..4834, 5203..5329, 5809..5984, 6311..6434, 7371..7563, 7685..7848, 8061..8277
1001..1064, 2018..2103, 2524..2652, 3818..3915, 4233..4343, 4653..4834, 5203..5329, 5809..5984, 6311..6434, 7371..7563, 7685..7848, 8061..8274
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved