Echinops_telfairi Locus ENSETEG00000015152
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000015152
Echinops_telfairi
ENSETEG00000015152
GeneScaffold_8612
SNORA38
1264..1394
13267
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGGGAGGATGGAAAGAAGT
ATTCCTCGCTCAACCTGTTTGTATACGTATAAGGGCAAGTCCTTAGAGGCCCAGAAACCC
GCTGGTGAGGGCCCTGCGAAGATGCTTCTAATTACTGGTGTCTGCTAGGCATGAGTGGGG
CATCCGTTGTAGAACTCTGTGAAAGGAAACAAGATTGTAGTAGAGATCCTGAAAGACCCA
GGGGAGTACTGGAGACTCCCCAGTTTTACCTTGGGGGTGCTGGGCTCTGGGTGAATGCCA
GCTGTCCTCCTACAAAGGCGTGTCTGTGGTTCCCTGTCCTTGGACACGTAAGAATTGGAG
GCAAAGAAATGTGGATTTGGAGAAGTTTGGGGCCAGCTTGCTCCTCGCAGGCTCCAGCGC
CCCCATCCCACACTGACTACTGCATCTCAGCCTTCCCGGTAGGCATGGTCAAAAGTAGGG
GGGAGGGCTGACTTGTCCTAGAAGGCTGGAGTGAGTGGGCTATAAGACCTTGAGGATGTG
GGAACAGGACTCATGGTGGGGGGCTGTCAGATTCTCAGCGGGAGGCATTCTTGACACACT
CCGCCTTTTCTCCAGTTGCCCCTCGCCATGGCCTGCAGAGTCTTGGGAAAGTTGCCATTG
CCCGGCGCATGCCGCCCCCAGCCAACCTTCCGAGCCTGAAAGCCGAGAACAAAGGCAATG
ACCCCAACGTCTCACTAGTGCCGAAAGACGGGACAGGATGGGCAAGCAAACAGGAGCAGT
CCGACCCCAAGAGGTAGACGGGACCTTGGGGTGCCTAGAGTGATGGGTATTTTAATTTGG
AACTTCAGGGTGAGTTGGGGCTTGGTGTCCAGTGCAGCCAAAAGAGAACCAGAGAGGTCC
TTCTCTCCCTGGCCTGGGTCTTCTGTTACGTGACTGATCTGTCACAGATGGAGAGAAAGC
AGGAAGAAGCAGGACAGCCTATGGAGGGGGACACGGTTACAGTGTTTTGTCCTAGGGTAT
ATTAAGTGGTAATGGAGGGGCCTGGTCTCAGTCCCCACGCTTCCACCTGATGGAGTAGGG
GAGACTGCTCCGTCTCTGGTTAATCTTCCCGCCCTACCATTCCCATAGTTCCGATGTCTC
GACCGCTCAGCCGCCGGAATCGCAGCCACTGCCGGCTTCACAGACGCCTGCCTCCAGCCA
GCCGAAACGCCCCCCCGCAGCCCCCGAGGTACCTGAGGACTGGCTGTGGTCGGAGGCAGC
CTGGGAGGAGCTTGGCGCGGTGCTGCTCGCCTCACCACTCGTTTCATCTTCACCTCCTAG
AACGCTCCTTCGGTTCCAAGCGGGGTAAAGTCCTGGGCACAAGCCAGCGTCACCCATGGA
GCACACGGAGATGGTGAGTGTGGGTCTCCTTGGGAAGGTTTGTCTAGACACTGGGGGCAG
GAGCCCTGGCGGTCTAGCCTCGGTGCTGTGCCCTAACATCACGTTGGCTAAGTCTCGGAT
ACCATGTTCCATTTTATCGAGCGCGTGAACATGTTTAAAGCCTCAGATCATGAAGGTGGG
GGGTCTGGGCTTGAAGGCAGGCTGCTGGTGGACCCTGGTACCTCACTTGCCTGTTCAGTC
CCTGTCCTCAGTAGACATGCTCCTCGCCTGTTCTGCACCCCAACAGGTGGAAGGGCATCA
AGCCTACTGTCACGATTCTCTCGAGAGGAATTTCCGACCCTTCAGGCGGCTGGAGACCAG
GACAAGGCTGCCAAGGAAAGGGAGTCTGCCGAACAGTTGTCTGGGCCCGGACCAAGCCTC
CGCCCCCAAAGTAAGGGCCTGCTTTGGAGGTCCAGACTGTTTAAACCGGTCCCTTAACTT
TTGCCTGAGTGTCCCCCTTAGCCTCTTTCAGAGCCAGGTGCGGCCTCGTTCACTAGACTC
CTCTTTCTCAGCTGTGCTCACTTGCCCGCAACCACCTGTCTCTCCACTCTTCCTTTTCTC
CATTACAGACTCTACCACGTGGAGGGACGGAGGTGGGCGTGGCCCCGATGAGCTGGAGGG
CCCAGACTCCAAACTCCAGCATGGCCATGACCCCCGGGGGGCGCTGCAGCCTTCGGGCCC
ACCCCAGTTCCCTCCATGCCGCGGGATGATGCCGCCCTTCGTGAGTTTGATCTGGAAGCT
GGAGTGTAGGGACCAGGACCTAGCCCTTGGGGAGTCAAGGGGGACATTGGGGAAATAGAC
GTTTCGGGGATAGAGTGAGGGTGGGAAAGATGGTGTGGGGCCTAGGGAGCTGGCATGTGA
TTGGACTGATGGCTCTGAGCACCTGCTATTGGGTCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTGAGAAGCTCAAGCGGCTGGATGAGAAGTTTGGGGCCCATGATA
AACGGCTCAAGGCTGAACTGCTGCCCCACCCGCTCCCCCTCCACCTGTAGTCCTCAAAGA
AGCCCCGACACCTCCAGCTCCAGCGCCGGCACCAGTCCCAACCCCAGAGAAAGAGCCTGC
AGAGCCAGCACAGGCCCCTCCTGCCCAGCCCGCCCCCACTCTAGGTGTGGCTCCAGCCCC
CACCCTTGTGAGCAGTGGTGGCAGTACCAGTAGCACCAGCAGTGGCAGCTTTGAAGCCAG
CCCAGGTACGGCGATGAGGACGGGCCAGGTCTCTCCTCCTGGGGTTGAGGGACTGGGAGT
AAATGAAGACAAGGGTGTCGGGTTTGGGTGATGGCTTCTGTTGGTTTGCTTGTTTGTGTT
AATGGTGATTCACACACTTGGAGTATTGGAGAAGAAAGGTTCTGTTCCCTGAGGTTCCAT
GGGTCTGGGTGGCACAGATAACACCTGGAGTTACTGTGTGTGTGGCTCTGTAGGAAGTTG
TTGCCACCGCTGTTGGCTCTTCAGTGACCTTGAAGTGCTTTTATGGGTTTGAACTAGGAG
CAGGGCTTTGCTTCTTTGCTCTTCCAAGAGGGCGGGAGCTAGAGGTCAGAGCCGAGCTGC
TCGGGGAGTCACGGGGTAGACTAGGTCAACCTGGGTGTGTTCTTTCTTGCAATACAGTGG
AGCCCCAGTTGCCCTCAGAAGAGAGTCCTGAACCGCCAGAAGAAGTTCCTCCTCCCGCTG
CACCACCAGCCCCAAAGGTGGAACCCACGGGTGATGGGGCTGGCCCCGCCCGACAGCCCC
CCAGCCAGGGTTTGGGCTACCCCAAATATCAGAAGTCCTTGCCTCCTCGCTTCCAGCGAC
AGCAGCAGGTGGGCAGGTGGAGTCAGTCCTATGACTTGCCTTCAAAGAACTGCCGCTCCC
TGCCTTTGCCCGTTCCCTCCTGGCCCTCCTACCTGGCTGTGTCCGTTTAGAGTTTGTCCT
GTTCGCCTGTGGTTTGCTTTTCCTTTGCTTCTGAGAGCTTCGTTGGGCCGGCAGCACTCC
TCCCATCTCCTCTTTGTTCTTCTCCAGGAGCAGCTCCTGAAGCAGCAGCAGCAGCAGCAG
CAGTGGCAGCAGCACCAACAGGGCTCGGTGCCGCCTGCACCAGTCCCCCCATCACCACCA
CAGCCTGTGACCATGGGGGCTGGGACCGCTCCGCAAGGGCCTCACTCTCACTCTCCCAAG
GCTTTGTACCCAAGTGCTCTGGGCCGGCTCTCACTCATGCTCCCCATGAACTTTGATCTC
CGTTGGATGATGATTCCTCTCCTACGTGGATCTCTGGCTTCTCTAGGGGCCGGCCTCCTC
TGGACTTCTACTCTCCTGGCGTGCATCTCTCTAGTAAAGAAGAATCCTCTGTGGCTCGTG
AGATAGGATTGGAGTCTTTCTGGGGAGCTGTGATCGCCAGTTGAAGTGTGGAAGGGCCAT
ATGCTGAAGCTCTACTTGAGCTTGGCTTCTTTATCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGTGAGACCCACGAGAAGTGACCT
GGCCCCCTCAGAACAAGGAGGCCCCTCCGCCAAAAGAAGAGGGTCCTTACCCAGCCCCCT
CTTGCTCCTCAACTAGCAGCGGCCCCCCTTTCACCGGCCCCTGCTCGTTTCTACATGGCC
CGCAGCGAGCGAGTCTTCACGCCCCGAGGAGTGCCGTCCCGCCGAGGCCGAGAGAGTGAG
CAGCCCCCACGTGCTGTTTGCGCGAGCTAGGAGCCCACAGACCAAGCCCCTGGCCCCCAA
AAAACCTCCCATGGGCCCTTTGCTTCCAAGCAAGGAGTCTTTGAAAGAGAAGCTCATCCC
AGGGCCTCTGTCCCCCCTGGCCCGGGGAGGCTGCGGTGGCGCTGGCAGTGTGGGCATGGG
TGTGGAAGATGGCGAGCGGCCCCGACGGAGGCGGCATGGGAGGGCGCAGCAACAGGACAA
GCCACCTCGTTTCCGGAGGCTGAAGCAGGAACGCGAGAACGCTGCCCGCGGTGCTGACGG
CAAGGCGGGGCCCCTGCCCACGTCCACCTCTGCACCGGGGCCTGAAGAAACCCTGGCCAC
AGGAGCAGCACCCCTGCCACCGCCACGCCGGGCTGCCGCCAAGTCTCCTGACCTCTCAAA
CCAGAACTCTGACCAAGCTAACGAGGAGTGGGAGACTGCGTCGGAGAGCAGCGACTTTGC
TAGTGAGCGTCGGGACAAGGAGGCTCCCCCACCAGTGCTGCTGACCCCCAAGGCTGTGGG
AGCCCCTGGGGGCAGTGGAGGCAGCGCTGGACCTGGTGTTGGGAGCATGCCCCGTGGAGA
CCTGAGCCAGAGAGCCAAGGATTTGAGCAAGCGTAGCTTTTCGAGTCAGCGGCCAGGCAT
GGAGCTGCAGACCCGGCCTTCCAGGCCCCCAGGGGGCAAGACGGGCAGCAGCAGCGGTGG
AGGAGGTGGAGAGGGACCTTGTGGGGGAGGACTGGCCCAGAGGAGGAGACAAGAGGAACT
GGAAGCCGGCCTCCTGAGGAGTGACCCCCTGGGCTTCCTCGGCCTCCCCTATCTTCAGCC
TGGACCAGGTGATCTACAGCAACCCTGCTGGCATCCAGCAGGCTCTGACCCAGTTTAGCA
ACTGCCAATAAAGTGCAGCTGCACCAGGAGCACACCTGAGGCCCAAGCCTGGGCCTCCCC
AAGCCCCTCAGGGCTCCTCCCTGAGACCTCCAACCCAGTACCACCCCCCAGATGACCAGC
AGTAATGGTGTTAGTGCTGAAGCCCCCTTCGAGGAACCAGGGCCAGTGGTGAGAGGGTTG
GATGGGACTCCCCGAGACTTGCTCAGGGTGACTCCCAACTGTGAGAAGGGCCTCCCAGGA
AACCAGAGCAAATACAGGAGGAATCCTTGACTCCTTCTCATAGCTCTGGATTGTTAGGCC
TTAAGCCCGAGGGCCCAGGTCCTCGGGGAGAATTGAGAGATGCAGGCACGGAGGCCTTGA
CCCCTCACATCTGAAATCCTTTACAGACTGCCACTAGCCAGAAGAGTTACCGCCCGTGCT
CCCTGGAGCCCTGGATGGAGCCCCTGAGTCCCCTTGAGGATGTAGCTGACAGTCGGACAG
TGAAGTAGACCTGAGTGGGGATTCTCTGACGTCATTGAGTCCCTGCAGCCAGCGAAGTTT
CCCTGATGGAGGACTCAAGGGGACAGCAGAGGGGTCCCCCAAATGGCCTGGTGGTCTGTC
ACCCCTGAATGCAGTTTCTGGCGAGGGTCTCCCCAGCTCTGAACCCTCTGAGCCTCCTAA
GAGATGGCCACCTGCCCCCCACAATGGCGGGGGAAAAGGAGCTACCCCGGGAGCAACCTC
TGCCCCCTGACCCTATTGGCACAGAGTGATCACTGTGTACTGCCTGAGACCCTGAGCCTG
GCCCCTCCACCCCCTCCCAGGGACCTGGGCCCTCAGTCCAGTGTAGCACCAGTGATAAAG
ACACAGAGGTCTGCCTAGTGGTGGGATACAGTTTAAAAGCTGAGAAGGAGCTAACAGCGT
CAGCCACTCAGGCCATCCCCCTATCCCAAGACTGGGAGCTGCTCCCCAGCACTGCTGCCT
CTGCGGAGCCACAGTCCAAACCCCTGGGCTCTGGGCATTGTGGCGGCCCAGAACCCAGCT
CCTCAGGCCCACACCTCCACCCTGAGGTCTTCTAAGGCAGCCTCAGGCCTCCTGATTCTC
AGGTGTCTGGGGGAACCACAGAGCCTCAGTTACATCCTAACAATGGGGGTTTCCACCTGG
GGATACCTTCACTTCACCCTTGCAGGTCACAGCCCCTGTACCTACCCCCAGGCCCAGCCC
CTCCCTCAGCACTGCTCTCTGGGGTAGCCCTCAAGGGGCAGTTTCTGGATTGTTCGGCAT
TGCAAGCAACAGAACTGGGGAAGCTGACGGCTGGAGGGGGACTCTATCCTCCCCCTTCCT
TTCTCGTTCTCCAGCTTTCTGCCTTAGCCTCTGTAGGACCCACCCTTGCTGCAGGTACCC
CAGGATCTGCCATCCCCTGCGGGTTTTTATTCTATTCCTTGGCAGCCTTGTAGCCAAAAG
GGCTTCCTCCCCGCAGGGGCACTGGCTCAGCAGAGGCTTCTCCCATGTTAGACTCACAAC
TCCCTGTGATGAACATCAGCTCTCTGCCGCCAGCACCACCTCCTGACCCCGTCCCCTCTC
TCTCTTACCTCTGGGCCCAGCTTTGCAGCCCCCCAGCTTGGCTGTGCAGCCTCCACCTGC
TCCTACTACTCTGGTCCTCCCTTCACCTGCCAGGCCCTTCCCTGCTAGCTGGGGGCAAGC
AGAACTACACCCGGCGGAACTAAAGCCGTTCCAGGATTATCAAAAACTGAACAGCAGCCT
TGGGGGGCCTGGGGCTTCACAGACTCTCCCACCTAGAAGGACTTTCTTGGGTCTCATTTC
CTGTCTCAAGGCCCAGCCTTCCACCTACATGGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGAAGGGCCCTCTCCATAGGCAGAGGAACCTGGATCCCCAAGGGACAA
GGACCCTGGGTTGCCCCCACCCCGCTGAGGGGGAGTTCCTCTATCCTCCTTGCCCCTGGG
GCTTGTATATAGATTATAAGTACATAAGGTGTGAGTGGGGAGGGCCTTTGGGGCTGAGCC
CTTGTTTCCCCTCCTCCCACTTCCACTGGTCCCCTATCCCTGGGGCTGTTTGTTAAAAAA
GAAAAAGAAAAGGGTTAAAAAGAAAGAAAGGTGCTTGGGCTGTCAGCCAGCATGTGCCTA
GAGGTTCAGATGGCAAGAGTTCATCTGACATACTTTGGACTTGTCAGGAGAGACCAGCAA
CCAGTCCCTGGAAAAGGACAGCATGCCTGGGAAAAGGCATCATGTTAAGTCAAGGAGAGG
TTCCATGGAAAAGAAGGAAATTCTCCATGAGATGGGTTGACACCATGGCAGCGACAATGG
GTTCAAACAAAATAATTGTGAGGACGGTGCAGGACCAGGAGTGTTTCTTTCCATTGTCCC
CAGAGTCACTAGGACACCCAGCCAGCGAGGCGGAAGCTAACACGAACAATAGCTAGTGAT
GCTGAATAGCTTTTTGTTTGTTTGCCATCCTTATCCCCCCTTTGACGAAGTGTTTCCTCA
AATCTTGCCCATTTTCAAATTAGGTAGGCAGTTTTGTTTTTGTTTGGTGGTATTTATTTG
TTTTTTGTGCCATACTTTCCCATTATCTTTCCCACAAGGGGGATTCAAAAGGTTCATGAA
AATGTCGTTTTTCATGAATTTTTGAAGGCCCACCTACTCTGGTCTCTTCTCAGATATATG
ATTCATAAATAAATATTTTTTTGTTGTGGCTCTTGTGGGTTGGCTTTGTCATCTCAGCTC
TGTATGTGAAACACAAGTTTTTAATTTGTTTGAAGCCCAAGTTATAGACATTGTTTTTTC
ATCAAGATTTTCTCTTCAGGGTATCACAGGTTATGCTTCGCATTTTATTTTTGATCCTTT
TGAGTTAATTTTTGTATCAAGTGTGAGTGTTAGGCCAAGGTTCGTTTTTCACATCAGGCT
AACCAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1040, 1042..1083, 1575..1752, 2088..2187, 2280..2352, 2626..2769, 2948..3099, 4055..4134, 4235..4377, 4478..4568, 4669..4885, 5666..5896, 5899..6124, 6537..6727, 6927..7054, 7057..7070, 7072..7158, 7160..7182, 7187..7232, 7719..7929, 8294..9171, 9173..9191, 9193..9218, 9220..9387, 9389..10098, 10101..10118, 10121..10141, 10146..10160, 10164..10190, 10193..10267, 10271..10367, 10369..10379, 10404..10475, 10478..10480, 10484..10630, 10634..10729, 10732..10953, 10958..11005, 11009..11023, 11027..11311, 11315..11584, 11587..11604, 11607..11612, 11616..11738, 11741..11806, 11809..12088, 12093..12133, 12222..12233, 12236..12238, 12241..12267
1001..1040, 1042..1083, 1575..1752, 2088..2187, 2280..2352, 2626..2769, 2948..3099, 4055..4134, 4235..4377, 4478..4568, 4669..4885, 5666..5896, 5899..6124, 6537..6727, 6927..7054, 7057..7070, 7072..7158, 7160..7182, 7187..7232, 7719..7929, 8294..9171, 9173..9191, 9193..9218, 9220..9387, 9389..10098, 10101..10118, 10121..10141, 10146..10160, 10164..10190, 10193..10267, 10271..10367, 10369..10379, 10404..10475, 10478..10480, 10484..10630, 10634..10729, 10732..10953, 10958..11005, 11009..11023, 11027..11311, 11315..11584, 11587..11604, 11607..11612, 11616..11738, 11741..11806, 11809..12088, 12093..12133, 12222..12233, 12236..12238, 12241..12264
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved