Echinops_telfairi Locus ENSETEG00000001712
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000001712
Echinops_telfairi
ENSETEG00000001712
scaffold_155807
SNORA70
1345..1475
2837
ACATTGTGTCGAGGGCGGAGGCTAATTAGTGGAACTGACTTGCCCGGGAAAGGAACCCC
ACGTTTCCCCCCAGCCACTGAGATCGTCTCGGGCTTCGATTGTGCTCAGCGCTTCATTCC
CATCTAAGTTCCATGCTGCTGTCGGCTTCCCCCCCCTCCCCCCGCCTAGTTATTGGGGTG
CTTGGGCCAGCAGCTGTCTTTCCAGTACTTCGGATTCGCCCTCTTTTCAGCCCGATTCCT
CTTAGAGTCTTTGTGTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGGAAGGTGAGGCA
ATTCGTCCTGGTACCACCCGGAGCCGCTCAAGAGAATTAACAGCTGCACTCTGCTGCCCT
TGATAGTGACCTTGGGTTTGCTAGAGAGCAGCCACTCCGAGGGCCTGTGCTTAGGGAGCT
CAGTTTCTGAGATGCAATCCTGTCTCCTTTCTTGTTTAGCCCTGGAGGCTGCCCGCATCT
GTGCTAACAAGTACATGGTGAAAAGCTGTGGCAAAGATGGCTTCCACATCCGAGTGCGGC
TCCACCCCTTCCACGTCATCCGCATCAACAAGATGTTATCATGCGCTGGGGCTGACAGGT
GTGCGAGGCCCTGTGTTGGGGGCACAGGGCAGCTCAGTGTAGGGTACCCCTCCTAGCTAT
TTTCCATGGCCCAGCCCTGCTGCAGACAGTGACTGGCTTCAGCTGACCCAAGCCACACCT
GAGCAGAAGCAAGGAGGGGGGCAGGGTTTCTCTCTCAGCTGGGAAATTTGTGGGTCTTCT
GGGTAGCTTTGGGGTGTTTTGTTCTCTGCAGCCAATTAAGCCGACCGTCCTCCTTGTGGG
GGCCGGTGTGCAATGGCTGCAAACAGCAAGCCTCCTCGGTAGTGTATGCAGCCTATTGTT
ATGTATAGGCTGCCCTAAGGGACCTTGGAGACAACCTTTTGCTGCTTTTCAATGCCTCTG
GCCTGGCTAATTTCTGCTCTCCCTAAACTAGGCTCCAAACTGGGATGCGAGGTGCTTTTG
GGAAACCTCAAGGCACGGTGGCTAGAGTCCACATTGGCCAGGTTATCATGTCCATCCGCA
CCAAGCTTCAAAACAAGGAGCATGTGATTGAGGCCTTACGCAGAGCCAAGTTCAAGTTCC
CTGGGCGCCAGAAGGTGAGCCATACAGCCATCCCTTTATCTCTTGACCTGCCTTGCCCCT
GCTTCACCTTCCTGTCTAATGTTCTTCTCTCTCCTTAGATCCACATCTCCAAGAAGTGGG
GCTTCACCAAGTTTAATGCTGATGAGTTTGAGGATATGGTGGCTGAGAAGCGCCTCATCC
CGGATGGCTGTGGAGTCAAATACATCCCTAACCGTGGCCCCTTGGACAAGTGGCGGGCTC
TGCATTCATGAAGGCCTTGGTAGCCCTGTGCTGCCTCACTTGTACCCAACAAATAAAAAT
TGAACTTCCTGGTTTTCTTGGCTCTGGATTTCCTACTAGGGGGTGAATGATGCTGAGTGG
GAAGGCCCTTGGGTATTCTGCCCCACTAGCTTGATAAGTGCCTACTCACAGGAGATAGCC
CTCCAGGGGACCTGCAGGGAGGCATTTCCTCTGAAAGCCCTGGTCCTGTCCTGGCTGGGC
CCACAGCTGGTAATCATGATTGAGTTTGGCTGCAGTGCCATGTGTCTACCCCTCTGGCAG
GAACCATCCTGCAAGGATCTGTTAAGTCCTAGTTGGGAGTGCCAGATCCCATGCTTCCTG
TCCTCACCTGGTCTTGAATCCCTTCCCCACAGGCCACCAGTGTCCTGTTCCCCCAATGCC
TGTGCAAATGCACGCGCACACCAATCCCAGGCACAACTGAAATTTTAATTACCTTTATTT
TTGTTCTCATGGTTACAACAACCACAAATTAACTCTATAAAGGACCCAATCCTTTTCCTG
CAGGGTCGCCTGACCCCAACGCTGCATGGCATGGGTTCTGAAGACACCCCAGCTCCTGGG
AATGTGGGGTGGAGGCCAGGTAGATTTAGGTGCACCCTTCCTCGCATCTAGGTTCACACC
TGAGATGTGACTTATTGGTTAGCTGGCATCTTGGGATCTTAGCATTGTTCTACTGATGAA
TAGGTCAGGCATGAATGAGCCTTTGGCCTAGCTGCCACCCAAAGGGATATCCCTCCCATG
AGCCCAGGGAAGTATTCCTTTATAGATCAAAACTTTTTTTCATAGAATAAGATCTTGGGA
TCGCTGGTCATTGTCTTGGCTGAGCCCTCTCCCCTTCCCCAGCTTCCCATGGGCTACTTT
GTACCCTCTCCTGACACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1137, 1531..1693, 1778..1930
1001..1137, 1531..1693, 1778..1927
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved