Echinops_telfairi Locus C6orf48
snOPY snoRNA Orthological Gene Database
Echinops_telfairi C6orf48
Echinops_telfairi
C6orf48
scaffold_260944
SNORD48, SNORD52
1514..1577, 2037..2100
3307
TAAATGCCAGGGGGGAGTAAGTAATGGGATATATTTCCTGCACTCACAGTGGCCACCTT
CCAAATTTTTATGCTCACGGCACCTAAATTCTATGACTCAAAAAGATTGGTTTTCCAAGG
TTTGCAGCCCCCAAATCACCCTCTTGCCTTTCTCACAAAACATGAAAAAAAGAAAAGATG
CCAACATAATCACCAAACACGATCTGCATTTGGAAACGAGGGAAGTTTAGGGTGGGATTT
GGGATAATATACAAATCGGCGAACGAACTCAAAACCCAAACACACTGTCCTAATGGTCAT
AGCGACGCCACAGGGCAGGGTGGGACTGCCCCTGTGAGCTTCCAAGACAGTCACTGCCCT
TGGAGAACCAAGGGCAAGTACAAACGACTTAAAACAGGGCCTGTCAACAATCGTAGCCCT
TATTCGGTTAGCTCACAACTCCTGCACGCCCACCTGGTGACGGTGACAAATGGCGCTATT
CAGAGAGCACCTCATACTTTCCCTTGTCTTGGGCCAATTTCCGGGCCACCCACCGCTCAG
GTGGCACCGGTGAGGACGAGGGAGAAGTAAGTCCATGGGCTTTAAGGGCCCGCGCAGGTG
CGGGTCGCTTTCTTACTGCCCGGCCACCTGTACAACCGACGACTGGACGGGCCGGCAGGG
GGCGGCAGAGGGCCCACCCGCGCGCTGGCGCGCCGGCGCCGGGGGCTTTCTCGCGCCTGG
CCAGCCAGTTCACCTGTTTTTTGTTTTTCAAAATTCACACAACGCCCCAGCATTGGCTCA
GGAGAACGTTCAACATTCTCCCATGGCCTCTTTGTCATCTTTGTCACTCTGCCTCCTTCG
TATTTGAGTGGACGGTGGCGAGAAAGTCACGGATCCAAGCAGGCATCTACGAAGACAGCC
ACGCCGTTCAGGCCCCCTAACCTCGCCTGGCTATAAATAGCGCTGGCGCCGCCCCATTCG
CTCTCTTGTTCCTGCTGTGGCCGGACCTGCACGTGGTCACTATGGAGGGGCTCTCGTCCG
CCGGGCCTGCCCGGTGCTGCCGTGGTGGGAAGGGAGGCCTCGCCGCCAGGGCGCCCGGCG
CCTTCTTGGCGCGTCGCCGCGTGCAGGTACCGGGCGCCAGGCTGGGTGAGGGGACGTGGC
CTGGGCTGAGAAGGATGAATTCCCATTACAGACTAGAGTTTCTGATGTCTCCGTGACGCC
ATTGCTCGGAACTGACCCAGCCCGGACCAAGGTGAAGTTGATGGACTCGACCAAGGCCTC
TGCTGACGCGTCTTTTTTGTTCCCCTTTTCTCCAGGTCCCCGAGTCCCGCAGCATGGTGG
CGCAGGGAGTGGGTGCTGGACTGCTAACCGCAAGGTCAGCAGTTCAAAACCCCTAGTCAC
TCCCCCGGCGAGAGCGAGGCTTTTTAAAACTGCCGTAAAGCGTTGCCGGGTCCCGATGGC
CGTGAGAGCCCGCCAGGCATCTGCTTGCAGCACCACAAGGTGAGTGTTGTGGAGTGGTGG
TCGCAGGGCGAGGGCGAGGATGATGACCCCAGGTGATTCTGAGTGACTTTGCTGACGCAT
CACCGCAGCGCGCTGACGACCCCTCTGCCCCACAGGCCGGGAACCCTAATCCCTGGGTTT
TGGGGAGAAGCCATGAGTCCTTGGTGTAACCCCTTTATTCTTAATTCCAGTGCCTCGGTC
CGTCAAGCTGTTGTCATTGAATAAAGGTGAGTTTCCCTTATCCAAGTGCTTCTATTGATA
CTTGTCCCCACGTTGTATCTTCAGGAGGCACAAGGGCCTGCCTGCTTATATGATGCATAA
GGAGCAGATGCAAATGTCTGCTCTTGATTTTCCAGGACCTTACTTCTTGCCTTACATTAC
TCGTGTGTTGATTTAGTTTCTGTAGTCGCCCATCTTTTTACTAAACGTTCAGTCTTAGCC
TTCCACTTTGTTTATTCGAAAGGAACGTTTGCGGTCTGCCCTGGGTGTTTTCCTCGATGT
TACTAGATCCGTGTTGGAGAATGGCTGCTCTCACCCACGTCTCCCGGCCCGACATTTGGG
AATGATGATTTCTCAGACTAGAGTCTCTGACTGGTCTTGATGTCTTTTTGTTGTCTGACT
CATTTGGGGAAGGCGGCAGACACTTGGGTTGCTGAGAACAGGACCTACAGGGATCTTCAC
TGAGCCGTCTCGTTCATTGATTATTTTGTTTCTCTTGCTAGTGAGAGCCACGGGAGCTCG
CCAGTACCCTTTCCAGCATGGCGGCCTTAACTCCATTACTGAAGGACTGGAGTCTGCCTG
CTTCTTGCAGAGAGCACTTTCAGATGCCCCCTCTAAAGCATGGCAGCCGTGGTGAGTGTC
CTCCCTTTTGCCTTCCAACCCAGACTGGGAATGATGACTTGGTTGGACAANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGCGTTTTGATGGTGCTGAATAATATCATGCGCCCCTAATTGGCCT
TTTGATGTATCCATGAAAAGATCATTTCTCTTAGAGCGGATTCTGTTCATGGTGCTCATC
AGATATGAGCATTTAACAATTTTAGGCACCTTGTACCTGCGAGGACAGGAGCCCTAGTAG
GGAATTACTCTCTTAGAGGTGTCAGCAGCCTGCTCTGCAGGAGAGCGATAGGGGCTTTCT
ACCTCTAGAAAGAGTTGTCAGGAATAGACAGTTCTACCCTGTCCTGTGAGGTTTGAGATT
TTTACACCCTAGAAGGTATGAAGTGCCTGCTAGAGATGCTGATGTGTGGTCCGAATGGAA
TGTCAGTTCTTAACCCCTCACTTGACACTCCAAAATGTCCCAAGTTAAATACTGTGATTT
TTTTAATGCGTGTAATTTTTAAAAATCATTTTACTGCGAGCTCATACATAAATAGGTAAT
TTTTGTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1006..1035, 1040..1093, 1098..1103, 1106..1114, 1117..1125, 1129..1134, 1136..1189, 1201..1266, 2202..2216, 2219..2224, 2227..2307
1001..1003, 1006..1035, 1040..1093, 1098..1103, 1106..1114, 1117..1125, 1129..1134, 1136..1189, 1201..1266, 2202..2216, 2219..2224, 2227..2307
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved