Echinops_telfairi Locus RPLP2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi RPLP2
Echinops_telfairi
RPLP2
scaffold_160932
SNORA52
2510..2646
4294
GCCCAGTGCTCAGGGCAGGGGTCAGTGAGACCTCGGCACCACAGGGGCAGGGCCTCGGC
AGGGGAGGAGAGGGCCGGGCTGCAGGCACCCGATCGCGGGGCGGCTCTAGTTCTAGGGGG
AAGACGGAGTGAGCGGCCCCACCACCTGACGAGCACCGACTGGATGAGAGCGACGCTCGG
GCGCTGGAGGACATCGAGGAAGCCCCAGTGACAACGGCGAAGCGCGGTACAGTTCTAAGC
CCCACCCAAGACCACGTGCAGACTCGCGGCTCGCACGGGATTCAGGCGGCGCTCAGGCGC
TTCCGACAGTGATGCACTATGGGACTTCTAGTTCGCCATCTAAATAAGTTTCTGCTGCGC
AGGCGTGGTCCTGGCCGTTGTGTCCCAGGCCGTCGCATTGCATGCTGGGAGTTGTAGGCG
CTGTGTAGCACGCTAGGAGCGCGAGGCCCCGAAGAGAGCAGCAGGCGAATTCCGACTCGC
GGCCTCCGTCGAACGACTACCCAACAGACGCGGGAGGACCTTCTCCCCATGCCAAACGAG
AAAGTGTCTCAACAAAGTCGTCTGCGCCTTTGCTACAGGGACTGCGTGACTTGGGGCAAT
GGCGTCCCGTCGGTCCTCATTGGCTTGGCGCTCCGTGACGTCACCAGGAGGCGCCCTAGG
GGTGGCCTCCTGCGTGCCCTAGAGGCTTCTGGGTAGCGGTTTAATCCCGCCCCTTGCGCC
GGCGCCTTCCTTTTCCTCCCTGAAGCCAGCGAGGTCGCACGCGTGAGGCCTGTGCACCGC
CGCCGAGTGAGTAGGTCTTCCGCGCCGCGGAGCGGGCGCTTGGGCGCGGGGTCCCGGGGT
CGCGGCAGCTCCTTGGTCCGCAGGTAGGCTGCTCCGGGCGGCCGCTGGGTAGGGGCCTCC
GGGTCAGGCCACGCTCGGTCTCACTTGGCCTCGGGCCGGAGGGGCCGCGAGTAGAGGCCT
CGGGTAACGTGGCCGCTGGGACTTTTATGCCACCTTTCAGAATGCGCTACGTCGCCTCCT
ACCTGCTGGCCGCCCTCGGGGGCAATGCGTCTCCCAGCGCCAAGGACATCAAGAAAATCC
TGGACAGCGTGGGCATCGAGGCCGACGACGACCCGGCTCAACAAGGTAGGCGAGCCTGCG
AGGAAAGTCGCGAGAGGGCCTTTTGGGCCATCCCGTGCCCCTTCCGTGGACCGCGATGAG
CTGACTCAACACGATTAGCGTTCCTAACAGGCCAGCTGAGTCTGCGAGAAACGAGTTTTT
CTGTACCCCTTAACATTTACAGCCCCAGGAACGCAAAAGCATTTTAAGTCTGTTCTGCAA
AGTCGCTGTGCGTCGAAGCTGAATAGCCAGGCTCATGTAGCAAATGTGGGAGCAAGGGCC
CCGACCAGGGGAGTGACTTGGGCACCCTTCTATTTTTCTTTATTATTAATAAATAATTTA
TTTGGGGGCTCTTACAGCTCTTGATAACAAGCCGTACACCAATTGTATTAAACACATTTG
TACATATGCTGCCATCATCGTTTTCAAATTATTTTCTGCTTGAGCCCTTGGTATCAGCTC
CTCTTTTTTTCCCTCTCTCACCCTGGGGCATCCCTTTCATGATAAATGGCAAGAGAAGTT
ATTTTCTTTTTCGGTAGATAAGTTCATTTAGCCATATGTTTCACTGGCCTGATAACTACC
GGCATATTCAGTTCTGAGGCATTTTTTCCTATTCTAGTACCCTTTCTTGACCACGTTGCC
TTCCTACCTCTCCTGCCATAATCCCGAGGCACTATTAATCTAGTTTATTGTATGCAGATT
TACTGAGAGATTCGTTTTGAAACTTCTGCTCTGAGCAAGGTGATGTGGCCTTAGAAAACC
TGCCTTCGTTGAGAAGTCACATTCCCCGTGCCGATTTGGGGGTACTTCTTCCGTTTTTAA
AATCATTTTATTGGGAGCTCATACAACTTAGCATAGCACAATCTATACATACATCAATTG
TGTAAAGCACATTGGACATTCGTTGCCCTCATCATTCTCAAAACACTTGCTCTCCACTTA
AGCCCTTGGCATCAGCTCCTCATTTTCCCCCTCCCCTACTCCCCTCCATCATGAACCCTT
GATAATTTATAAATTATTATTTTGTCTTATGGTACAGTCTGATGTTTCCCTTCACCCACT
TTTCTGCTGTCGTCTTGGGGCATTTCTGACCACATTTCCTTGTTAGTAATGATAGCACCC
TGTGTAACTTGTTGATGCTACTCCCCGGTGTCAGTTCACAGAGGTGGTCAGTGTTGAGCT
CCAGTGAACACTCACTACCTGGATATGGTCACAGCTGAGCGGCTGAAAGGAGCAGGTACC
CTTCGGGCCCGGCTGCCAGTAGCTGGCTGCTTCCACTTGGTTGCTAACTTTGGCACCTGC
GGTTATCTGGTTCTCCCTGCAGGTCATCAGTGAGCTGAACGGGAAGAACATTGAAGACGT
TATTGCCCAGGGTAAGTGTCTGTTGTGCGGCGATCCCAGACTCAGCTCTACAGTCCATCC
TAATCCCTGCTGGCCAGGCCGTGGCCCACCAGGGTTCGCTTGTGGACCAGATCACCCTAG
GAGCCTTGCCCAGCGGATCGGTCAGACTTTTGGTGGCCTCACTCCATGGGCATGCTCCCA
GGACAGCACACTAACAAGGAGCTGGCTTTAGGGCAGGGTCTGGGGAGCGTGGTTTATGGG
ATTTGCCCAGGGGTGCCAAGTGTGCCCCTGGCAGATGGCTATTCCCTATCCTCATCTGGC
CCTTGAGCTCACCCTAGTGGTGGGGAGCTGGACCTGGGAGCAGCAGCTGGCTGTAAACAT
GTTTGCTCAACTTCCTGTTGGGAAGATGCTTAGAGGCAGTGTTAGGAGTACCCAGCCAGG
CCCTTGGGGAAAGCAGGGCTCCAGCTGAATGGAGAGCAACAGCTAACCTGTCCTGGGAGC
CAGGGAGTGCCCCTGCTGTACTGACAATCCCCAACTTCTCAGTGTCCACTCCACTTGTAA
CCCCAGACTCAGGAAACTTACCTTGGACTCTGGTTCCTCCCTCAGGTATTGGCAAGCTTG
CCAGTGTGCCTGCGGGTGGTGCTGTGGCCGTTTCCGCTGCCCCAGGCTCAGCAGCTCCTG
CTGCCGGCTCAGCCCCAGCTGCAGGTAGGTGGTGCTCTGAAAGGTTCTCCAGTTGGGGGT
TTGACCCTGGGCTCACTGTCCTGGTCTTTTCCCCCCAGCAGAGGAGAAGAAAGACGAGAA
GAAGGAGGAATCCGAGGAGTCAGATGACGACATGGGCTTTGGCTTGTTTGACTAACCCTG
CCTTCCAAATAAAGCCTTTTTATGTATCCAAGCCACCTGGCTGTGTTCTGCACACCGGGC
ACCTTGTTCCAGTGGGAGAGCAGAGCTTTGAAGACCCTGGGTGGGGCTTTAGGTGAACAA
GGGGTGTCTGGTGCAGAATTATCCAGTCACTACCATCGGCTCCTTTCTAAACCTTCACTG
GAGCAGTCTCCCATGGGACAGCTGGTGAGTTTGAACTCACCCAGGCACTCTGATTATGCT
GATTCATAAAGACCCTATAGGATAAAGTACAGCTGCTCCTATGGGTTTCTGAGACCAGCT
CTTCATAGAAGTAGTGGATAGCCCTATTTTTCCCCTCTGGAGGGATTAAAGATTACTGCT
CAACACATAACCAGTACCATGTGGCTTCTGAGACTGAAACGCCTTCAGTTTACCACTGGT
ACTCCATGTGACTCCTTTCCCAAACTGTCCCGGAATGCTCTGAGTCAACCAGGAGGCATT
CTTCTTGGAATGTGTGGGAGAGGACGGGCCTGAGCTGCATTATTCCGGCCCCGCAGGGCC
CCACCCCACCTCCCCCAATGCAAAGCACGTTTCAGTGATGCATGTTCACCTAGTGGGCCA
GGCCCTATTCTGCCATCTGGTCTTCAGCCAGGACTTGTTCTTGGGAGACTCCATGGGGTG
TTGTTTCTAGGGTGCTGCCTACACGGGGTAGGGGCAGTTTGAGCCACCCAGAGAGTCTTA
GCCACAGGAACCCTAAGGACCAGCTCCTTGATAGAGTGGGGCATTAGCAAAGGACAAGTA
GGGTGGGGTAACAGGGCTGCCCTTTGCAGCTTGGAAGGGAGGGGTTAGTTAGAGCCCAGG
GGCCCGATCGGGTTGGAGTGCTGGGCCATGGACAGTTATCACAAGAGGGGTGGGAGGACA
GACTACCTACCCCACCCTGATTCAAAAGAGGAATGGGCCTGGGGCCATCTTGGGGACTGA
GCTAAGGGAATCAGGGCTACCTCGGGTTAAGGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1110, 1112..1124, 2422..2470, 3045..3143, 3218..3294
1001..1110, 1112..1124, 2422..2470, 3045..3143, 3218..3291
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved