Echinops_telfairi Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi EIF4A2
Echinops_telfairi
EIF4A2
scaffold_313097
SNORA63, SNORA4
4571..4703, 4897..5035
7529
ACTGAGTGGGGAATAGCTTCTATGGTAATGAGTAGAGTATATTATGCGCAGGCAGTTAG
AACTCACGCTCCTGAAAACAAACAAAAAGCAAAATTGATGGAAACCCAATCACATCTAGT
TCCAAAACAGCGTGTGGAGCACATCTAGTGAAATGCCGGCGTTACAAGGGCAATGACTCT
TGCTTAACTTTTAGCCATGTGCAAAAGTTAACAATAATCATAATTATCAAGCAAACCTAT
TAGGTTAGGGTGGGTTTGTTAGCAATTTTTAAAAGAGCAAGAGGAAAGCAGAAGCAACGT
GGGAACAGCGTTGGCTGTTGCAGACGCTTGTAAATAACCGGTTTTCCCCCCTCGTGCTGT
AAAATACACCGATAAACAGGATTTTCCGAGACGCGCTGGCTTTCTGCCCCAAAAGGGAGC
TTCCCAAATGCATAACCCGAAGGGCTGGGAAACGCTCGGGCAGAAGACCAGGTGGTTCTT
CCGCGTCAAATTAAATGGCGGCGGGGTCAGGCGGAAACACCGAGTCCCCTTCAGCACCTG
AAGGTGGCTGTCCCTCTTCGCCAGCTGGCGGGCCCGGACCACCCGGTGCGCGGCGCCCCC
GGCCCGGACCCCCCGGACCCCGCCCAGCCCCCGCCCCCAGCCCCGCCTCTGCGTCAGGGA
CGCGGAAACCCCGTAGGGGGCGGGCGGGCGCGGACCTCGAATCTTGGCTTTCATTTGCTG
CAATATTCTTCCGCCGCCTGTCAAAAGAGTCCCAACCTTTCCCCCACGGCCCTGGGATTT
CCCGCACCCCCGAAGTATCGAGGGACTACCAAACTTGGGGTTCTCCACCAACGTGCGCAA
GGTTGCGCTTGCGGTCACCACCTCAGGCTAAAAATCGTGTGGCAGGTCGAGGCGGGAGGG
AAAATCCCTCCGCGGGAAACAGGTTCCGGCCGCGAGCCTATAAAAAACGGGTGGCGCGGC
GCTGCTGTCTTTTCAGCCGAGCTCGGAGTGGCTTTTCGGACATGTCTGGTGGCTCCGCGG
ATTACAACAGGTAAGGCGCTCCCGCGGGGCGGCCTTAAGTGGTGGCCGTCATGCAGCGCC
AGAGGATGTTAGAGGAAGGTGGCACGAGGCGAGAGACTTGGGACTCGTGTTGGTTTGGGG
GTTCAGCACCCCTGTGTGCGCTGAGAAACTTCCGTAGTGTACGGCCCCAGCTTGTGGGGA
GAAGAGATAGGAGGGGCATGAAACTAGGGTGTCTAACGGGTCTCTCTCTCTCGGGGCTCT
CTTTGACATGCTAACTGTGTTCCTCCCGGGGCGCAGCGGGACAAATTGCCGTGGCGTGAT
CTGCCTCCGGCGCCGGGAGCCCAACCAGGGTCGCACTGCGGTCCGAGTTGTTTCCCCAGC
CTGCGGAGCTCCTTAAACATAAAAGGATGGGTCACTCGGCTCGCTCGGCCTGAGAGACAG
GTCCCAAGGAAGAGATTTTAGAAACAGTTAACATAAGGGCACGTGTACCTTAACAAAGCA
TCCCAGCCCCAGTGCTGTCCAAGCCCATAAATCGGATATTCTCCCATATGTTTCGACACT
GATCTACTAAGTCCTCCTCAATTTCACCAAATACACCCGCAATGATGCTTGCCTTGCAGG
TATGTTAAAAACCAAATCCCTAACCATATTACCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGGGCGGAGCTCGGCCTGCAGCTCTCGCGAGAAGGCGTACCGCTCGC
CGCGTCTGCGCTCGGGCCCGACCGGGGGGCGCCGGGCGGCCGCCCTCGTTTGCTGCCGGC
GAAAGGCTTGGTGGAGGGCGGGAGCGGGCAGCATGGCTTCCATCTGAAGCGTGGCTTGGC
GGAGGGGAGATCTCTAACTGCGCTTGTCTCGCCTGCAGAGAACATGGCGGCCCCGAGGGA
ATGGAGCCCGACGGTGTCATCGAGGTAAGAGATGGCGGGTGGCTTTGCAAACTCTTGAGA
AGATGCAATTGTGGCTCCAATTTACCCCGGTTTTCTTAAACTCTTTAACAGAGCAACTGG
AATGAGATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCTCTTCTTCGGGGTATC
TATGCTTATGGTTTTGAGAAACCTTCAGCTATTCAGCAGCGAGCTATAATTCCTTGCATT
AAAGGTAAAGCCCAATTCCCTGTGGCCTATTTAAAAATTGAAAAGGAATTCTTGTTCTGC
GCAGATGTCAAGGGTAGCAGGGAAAATAACCTGGGGGACTTAGCCACCTGTTTGTATTCC
TTAAAAGTGAAATGATGGCAATCATCTTTCGGGACTGAACCTGAAATGAAGAGAGTACTC
ATTGCTGATCACTTAATGATTGGGCGTGATTCATGTTCCAAGTGGAATACATGGTGTGTG
AACTAGAAGTGACGGTTTGCTGTGGGATCGGTAAATATGTATCCTACTTTTTTTAGGGTA
TGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCAT
CCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAG
AGAACTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAACTGCTTGCGTGTTGCATAGGT
TTCAGGTTTCACAACTGTAAAGGATTTAAGTTAGTGTTAATTGGTCCTGCCAGAGCCCTT
TCAATCATTGCCTATGCATGCAGGGTAGGTGAGCAGGAACTGGGTGTGCAGCTAGCTTTA
TTTGCAGGTTTTTCCAACATTGAGAAACCAAAGCTTTCTCAGGTTGTGCTAGTGTCTACC
ACTTCAGGTTCAATGCAGTTGTGCAACATGAAAACTGCAGTGACATGTTAACATTTGACT
GTCTCAGTAGTTTGTGATGCATCTGTTGCATGCTCTGTTTTTCAAAGCTGTTATATTGGC
TTTGAAGTAAATCTTCCTAATAAAGCGCTAAGCTTTATTAAGGTCAAGACTAAGATAGTG
TGTACTGTGGGAAATTTTTTAATGGACGCAATTTCCCTATATGTAATTACAGAGCTGATT
TATTGTATTTTCTACATACCCACTGAAGAGTAATTTAGGGGTTATTTTTAGTACAATTAG
CTGACAAGACCCCAAGTTTGACTAGGTACAAGAATAAGACCTTATGGGAAAGATGACAGT
GTGTTCAGTCTGCATTTTAAGCTTGGAAGTAGTTAGGTGCTGTGCATGCATAAAAGCTGT
TTGCAGATCAATAAGGGTATTGTTTTGGAAGTTAGTTGTTAATGCCCGGAGTTCTGTAGG
ATAGTAATTAAGGTTTCTGGCTTTTAGATCCAAAAGGTTATCTTGGCACTTGGAGATTAT
ATGGGAGCAACGTGCCATGCATGTATTGGTGGAACCAATGTTCGAAATGAAATGCAAAAA
CTGCAGGCTGAAGCACCACATATTGTGGTTGGTACTCCAGGGAGAGTATTTGATATGTTA
AACAGACGATATCTTTGTAAGTATTACTCCTTAAAGCACACAATTTGAAACACTTATTGG
TAAATAGAATAGGAAAGTATGGTTGCATCCACAAACAATTGTGTGTTTTTCAACAGCTCC
AAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGAGGCTTTAA
GGATCAAATCTATGAGATTTTTCAAAAATTAAATACAAGTATTCAGGTGAGAATTTTATT
TTGCTCCTTGCGTGTAGACTTGGTTTCGTGCTGTTTACATGATTAAAGTGTACCTCTATC
ATTGTGGTGCTTTCTTCCCCCCCTTAAGCAGTTGGTATGTAGCTCTAGTTGAATTTCATA
TAAAGTAGATCTGTGAAAGCTGTGTGTACTTCTTGGCCAACGTAATTCTTTTTTCAAAGG
TGGTGTTGCTTTCTGCCACCATGCCTACTGATGTGTTGGAAGTAACTAAGAAGTTCATGA
GGGATCCAATCCGAATTCTGGTGAAGAAGGAAGAATTGACCCTGGAAGGAATCAAACAGT
TTTATATTAATGTTGAAAGAGAGGTAATTGATAACCATAAGCACCCAGATTTTTTTCCTT
CTTGTATAAGCACTGTGCTAAAATTACAGAAACTGGGGCACTGTCTTGGTTTTTGTAATA
ATGCTAGCAGAGTACACACAGGAAGGAAATTGAAACTGCACCCGGTCTGGAAAGACTGGG
GCGGACCTCTTTCTTAATGTCCAATGTCCTTCGTCTTAAGATTTGGTGCGATAAATCTAT
TAGTGACTAGTGGAGCATTTTTAATGATGAAAACAAAATAGCTAAACCATTTTCACTTTT
GCAGGAATGGAAGTTGGATACGCTTTGTGATTTGTATGAGACCCTGACGATTACACAGGC
TGTTATTTTCCTCAATACAAGGCGCAAGGTGGATTGGCTCACTGAGAAAATGCATGCGAG
GGACTTTACAGTGTCTGCATTGGTAAGAGTTCTAACCTAAGAAACTCTTTAGAACAGAAA
GTTTTTTATTACAGCAGGATTTAGACTACAATATAGCTGTTTAGTGCTATTTTGTCGTTC
CCCCTGCTCAAAGTAAAGCTGTTTCTTATCTATCCCTGTCTGCTAGTTTCTTGTAGCAGC
CCAGGGACGCTTGGTCTCATACATACTGATGCAGTTAACAAATACTGGCTTTTGACTACT
GATTCCTGAATTAAGGTTTGTTCATTTTATCTTGTAGCATGGTGATATGGACCAGAAGGA
GAGAGATGTGATTATGAGGGAATTTCGATCAGGCTCAAGTCGTGTTCTGATCACTACTGA
CTTGTTGGTGAGTCCATCTCTGGTGTTTTAATTTTCCCTACCAAAAGTTGATTTTTGGAG
GCAAGGGTTTTTTCATAACCTTTACCAGTGTGGGCTGTTTGGGAGAATAAAGAGACCACA
CTCCACAGTGGACTATACCACTTAGTATAGTTCGCTACTATTTTGTGGCCTACAGTTTGT
ATTACACCTTGCTCAATTGTGTGAATTAGAATTTGAACAGACACCATTGTATTTCAGGCT
CGTGGGATTGATGTACAACAAGTATCTTTGGTTATAAACTATGACCTACCTACCAATCGT
GAAAATTATATTCACAGGTGAGTAAATAGAATCTTGACTATTGAATTATGTTGGTCAAAT
AAATTCACACACTGCTGTTTTTCTCCCTGAAAGGTAACATCAAATCAGGGAATTGAAACC
AATGATGTAATTTTTAAGTTACAATGATAAGTTTCACTTGGGAAGGTTTAGGTAGTCAGC
AGTGGGAAAAAATTGGTCAGTCTGTAGTGGGAAGAGAGTTGTGGCCCAAATTGTGGCGAT
CAGGCTCTAACTTAAGTTGGTCCAAGTTTATGTTCCGAGTCTCACGTTGCTCTTGTGTCC
ATGTGCTTTTTTTGGATCGTGTCTTCCATAGTTGGGATTTTCTTGGTGTCGTCTGGTAGC
AATTTGTGTGTTCCCTGGTTTATAGTGGCTTTATCCCTAAATTGAATTGTACTTTGTTAT
ATGATGTAAAAAAACTTTTTAAAAAATACAGGAGTCGATAGCAGCAGTTGATGACGAGAT
GGCACTCAGAAACGACGTTGACGTAATTTAGGACGTGGATTCATAAGCGAAACAGCACAC
TGTTTGCATAAAGAGCGAGTCGGTATTTATATTTGTTTTTCTTTTGTCATGATTATTTAA
TATTTTAAGTTGCTCTAGTCTGGCATTTTTGTATATTCCTGTAGGTGGTTTTGTATTGTC
TGGTTTAGCAGAAAGGTAGATGAGTGTTTCGAGGTAACACATTTGCTGAGCAAAAAAAGC
AGTGATAAGTTTGGGTCACCATACCAAATTTGTGTTTTCCCAGTGGGAAAAATTGTTGTA
GGAAATAGTTAACCTTTCTGCATTTATATTTACAGTTCCAGAATTGCGTCGAAATGGATT
ACATAACTTCTTTTTGTTTCATCCCTGGTGTTCACATCTGTCCCAGGCTGACACCTGCTC
CTGGCTGGCTGGCCCACTTTGGTATGGGCTTTAATTTCACTACCCCAAACACATTAGTGT
CACCTGCTTTGTAAAAAAAAACAATGCTCAAGGCACCTGATAACCTATTTTGCAGCCAGA
CAGCCTTTGAATCCTTTTGGCACTAACTTGCAAAGGAGACTCTTTTCTCTAGATACATAG
CAGCTAGTGCTCCAATTACAACCACAAACCTGTAACCTTGATTAGTAAACAGCAGCTGAT
GGTTAACAAGTGGATCAACATGTGCGGTAGTCCATGCAGGGCTTTAAGTACCTTTCTAAT
CACTGTCATTTCTTCTCTCCCACAGAATTGGCAGAGGGGGTCGCTTTGGGAGGAAAGGTG
TGGCTATAAATTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCT
ACAATACTACAGTGGAGGAAATGCCAATGAATGTGGCTGACCTTATTTAATTCCTGGGAT
GAGACTCCTGAACGCCGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCT
TCTTTCTTTGGGAATATTTGAATATTGTCTCAATGCTCATAACGGATCAGAAATACAGAT
TTTGATAGCAAAGCGGCTTTAGCCACAAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCT
CTAGATTAGTAGACTGTTGGGGTTGGGTATAAAGATGGGGCCTGTAAAATCTTTCTTTCC
TAGTTCTGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTATGGAC
TAAAAGATATAAGTGCTGTATTAAATCAGCCAATTATGTTAAACTTGCATACCTGCCTTT
ATTGTGTTAGGCCTTTAAGACTGATTTTTTTTAAAGAAAGTATTTGAATGCATTTTGTTG
GTATTTATTCCATAAAGTATTTAATTAGTGTTAAGTGTGAACTGGACCCTGTGGCTATAC
CCCAGTAAGCGATCATATCCTAGTAGGGTTGAAGAAAACCCAGTAAAATTGCCATATTGC
ACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAAGTTGGTTTA
CTTTTTATTTCCAAAATGCAATATTTACAAGTACAGTCAAGCAGAATTAAAATTCAGCTT
AACAATTCTGAGTTAGCTGCTGCATCACAGTGGCACAGAGGCTGATCAGCTGCAGGTGTT
CATCAGCACCATTGGCTAAACACTGATCCACTTCCTGTAACAGAGGAGACTGTTAGCAAG
TAAAGATTACCCTCAGCTATGTAGTCAGACATTAAAGGTACCTACTTACTGCAAGCTTTT
CTGTAATAATAGACTTCTGTTTATCAGAAAGGCTGTCTTCAACGATGGTGTCATGGAATT
GATTGACCAACTGAGTTGCTGCATGTCCCTCATCTATCAGTTCCTACATAAAACACGTTT
TATATCATCAGTATGTTTGCTCAATTGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1958..2003, 2091..2223, 2516..2655, 3387..3555, 3656..3765, 3959..4102, 4384..4521, 4777..4866, 5097..5176, 6385..6529
1001..1029, 1958..2003, 2091..2223, 2516..2655, 3387..3555, 3656..3765, 3959..4102, 4384..4521, 4777..4866, 5097..5176, 6385..6526
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved