Echinops_telfairi Locus RPL39
snOPY snoRNA Orthological Gene Database
Echinops_telfairi RPL39
Echinops_telfairi
RPL39
scaffold_270013
SNORA69
3194..3324
4590
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCACAATTCACACATTGGTTCCTAACAT
TGATTTCGGTCCCTCATTCACTTTTCCTGCCCCTTCCTTCCTTCTGAGCTTTGTTCAGCA
ACTATCCACCTCTTTTGGTCTAATATGGTTGCCTGTTCTAAGGCGTGTACTCCTCCTCCT
CCTCCCTGGTGCTTTTATTCAATTTATAGGGCTATTGTTGGGCTCGGAAGCCCTGGTGGC
CTGGCAGTTCTTCTGGAGAAAGACGAAGCCCTCCATTCCCCCTAGTGTTAGTTTCAGAAG
TTACATGGGCGTGCTCGCTTCAGCAGCACATTTACTTAAAAAAAAGCAGCAGCAGCAGCT
ACATGGATGTCAATTCTACCCAGAGATCTCAGACAGTGCCCCTCCCCGCGCTTCCTTCCG
TGCACAGGACCGACGTCGTTAAGCGTGACGTCTCTCTCCTCTGCCTTTCTTTTGGGTTAT
GCCCGCCTCTGTCCTATCTCTGCATCCGGAGGGACTTACACGTTTGCACTTATTACGATT
CCCTCTAACTTACACCCAAACAGGGTACCCCTCTCAAACGTATAGAAATTCCCGAGGCCA
TCTATTTGTGGCAGCGGAATCAAAGCAAATTCAATGTCACATAGAGTGACCACAGTTTCT
CACGGCCCCACCGCGTCACAGTCTGGAGACAGAGTCGCACCGTAACTAACGTCACTTCCC
AGGATCCGCCCTCTTGAACACGTCCTAAAACGCGCTTCCGCCCTCTTCTCCCTCTCTCAG
TGTCTCTGCCATCCTGAGCGTGGTGTTGCTCCGACTTCACCATGGTAAGTGCATCGGCCC
CCATCGGCTTCCGTGGCGGGTTCCCGCGACCAGAGACCATCCCGGGGCGGCGAGGTGCGG
GGGCCCTTTTTATGTTTCCCCAAGAGAAGGTCGAGTATGGTGGTAGTGTGGAACTGCCGC
CGCCCAGGCTGATTGGAGGATTCCCCAACTTTCTGTCCCTTTCTCTGCACTGTCCCAAGT
GGGGGCCCTAATTCCTAAGGCGATTCCGGGGCCCAGAGAGACATCGGGTATCACTGAATC
GAGGCCTCCCTGCGGGCTCCCCATGACCGTGCGACTTGGCCGGGTACGAGAGGAGGAGAT
GGGTTGCTGGGTTTAGGCAGGGAAAACAATGACCTTGGCTCCGAGGAGTGAACCGCAGGG
TTGTGGGACTTTCTAGTCATTTTTCACTTCGTCTTGGAACCCGAGCGGCCACTTGTGGAC
GCGCGTGGTGCAGGCATGTGGGGGTACCATGTGCTCCTCTGTTCTTTTTGTAGCTTACCA
ATTGGCAGAAGCATAGGCTGGAGGCTTGTCGCCGGCATGGCACCTGGTATGCAAGGGCTT
ACTGGCACAGATTGCCCGAGAGTATTCCAGAGGCGTAGGAGGTAGTTGGGTGAAGAGCGA
CCCGGCTCCTTAAAAAGGCACAACGGGAAACTGAGAGGAAAAAAACCCCCGGTCTTATAA
ATAGACCCTAAAGGTTGGGATTCATTGCCAAGGTGGTGAGTAGGGCGGAGTAGATGGGCT
AAACATTACGGTGCATCCTAAGAAATCTTCCTGGCACTTGAAAGTAGTTAACCAACCCCC
ATTTTACAAAGTAGCGCCCTGGGCCTCATGGAATTGCAAAAAATTGGCAGTTCCAGGTAG
CTGAAATCGGCTCTTTTCCCAGGAAACCAGTTGCCCTAGCAACTCGCTTCCCTCTATGTG
GTCTGAGCAGCAGGCTAACTACTCCTTGCTGCGCTGTGATTTTTAGTTGCGCTGGGGATT
GGGCTGACTGCCGCCAGAGCAGGGTCACAGGGCACACTGTGCTTCACCTGGAGGTTACGG
TTCGGTGTGTATTGCAGCCTCAGACGGCATGTTAATTGGATCACCTGGGTGGTCTTTCTA
AATGGGTCTTCCTTCCCTTTCCCATCCCAGTCATCTCATAAGACTTTTAGGATCAAGAGA
TTCCTGGCCAAGAAACAGAAACAGAATCGGCCCATTCCCCAATGGATTCGAATGAAAACC
GGTAATAAAATCAGGTAAGGCTACCCGCAATCCACTTCCTTCTTGTACGGCTTTTTTTGA
GTGGTAACCCCCTCGTTAACAAAAACTCCCTGCTCCCTAAGGTTCGGAGCTAACATTGTT
TAGTTGTCGATTTGCTCCCATGGAGCTAGTCCTTAATCGAACATAATGTTCAAGGCAGAG
TGGGTTTGTGTGTGTAAGATAAACAATTGCTTGGTTCTAAGAGGCCTTCAGCGAATGCTT
TTGGTTTAAAGTTTGAAGATGTTCCTGGGCAGCAGTTGAGGGAGTTTGCCCAGACGCCAG
GTTGCCAGAGAGTTATTTTCGAAGTACAGCTAGTATTGTATAGGGGTGTTTGTTTCACTC
TTAGATGAAACTAGATTTTAAAACTCAGGTCACTGATTCATAACAGTAGCAAAATTAGTT
ATGAAGTAGCAACAAAAATAATTTTATGTGTGGGGTCACCACCACATGAGGAACTGCATT
AAAGGGTCGCAGCATTGGGAAGGTTGAGAGCGACTGATCTATAAGTTGCTGTTGAGAGAG
AGCATCGTGGTTCTCCATAGCGACTCACTGCCATTGAGTCGATGCTGACTCGTGACAACC
CTATAGGACAGGGTAGGGTTGCCCATGTTTCTGAGACTAACTCTTTCTAGAAGTAGAAGG
TTCATCTTTGAAGGGCAGCTGATGGTTTCAAACTGCTGGCCTTGCAGTAAGCAGATCAGT
GTGCAATCACTGTGCCATCAGGACTCCTAGCTCTGGAGCAGAACCTTTGTGCCTGCCCCC
CCCCCTTTTTTTTCTCTTGCTCTCAGCCTGGACATCAGTTGCCCCATCTGCTGGGAAGTC
CCTTGCTAGGTGGTTATAAGGAATGCAGGCACTACCTGGAAGCCCAGCCCAGTCTGGCTG
GCGTGGCCTGGTGTGACTTATCCAAGGGCCCTTGGCTTAGGGTGGGCTCCGAGCTGGAAA
GGTGATTTGTATTGAAAGCAGGCTGCAATTACAGTACTTCAGTTTGTGGAAGTACTGCCA
TTATCCTGCTGAGAGAAAAAGCCATGTTGGCCGGCTCTGGTTTTGCCTCTTCAGGTGAGA
TCATGACCGGTTAGCATGTACAATTATGACTTGACAGTAGCTCCTGGCCAGCTATTGCTC
TGGGGGTGGAGGGGTTGAGCTATATGAAAATTGGGTAGGAACTTGGGGAGCTTCCATTTT
GCTGTCCTCTAAAAAGGAAAGGGGGGGGTTAGAATCAAGGCCCTGTGTCTGAATGGATCC
AAGTTGTTAGCGGGTAATGGAGTTGGGGCTGACTTTGTAACGAGCTATTTCCCTCTGTGT
AGGTACAACTCCAAGAGAAGACATTGGAGAAGAACCAAGCTGGGTCTGTAAGGAGGGATG
GCACGCATGACCGCATTTTCCCAGTCTCAAATCATGTTGTGTTGCATTAAGACTTTCGTC
CCCATCTGATCAAATGATCTTTTATTGGCAAATCTGATTTATTCGTTTTTTGCTTCCTCA
TCAAGTCTAACAATAAATAATGTAAGGCTTTTGGTTTGAACTGTTGTTTTCCCATTTGTT
CTCAATAAATAAACTCCAGAGCCAGATGGTCTAGCAGCCCTGTGCACACTAGAGCTTAGT
TGCCAATGATAGAAATGTTCTGGGAGGGCTGGGTTCGGACATTTTCTTTAATTGTGACAC
CCATCCAGAAGTGCCTTGGATGACACAAATTGGGCACAACTTCTAGGTCACCACCCTAAA
ACCCCCATGGGGAACAATTCTATTCTGACCCACAGGGGGTTGCTGCTGGGCTGGACTCAA
CTTGATGGTAGCTAACAGTAGTGTGAGCCTAGTGGACCCAACTCTACTACCATCCAGTCA
ATTCCATCTGGGTGACCAGGACAGTAGGAAGCCTGTGGTTTTCTAAGGCTGTAGCAGTCT
GCCTCATCTTTCTCCCTTAAACTGCTGGCCTTGGCCACCAGGAGCCCACCTCATTAGAAA
AATAGAGTTGGCCCTGATGTTGACAGTATTGGATGGTATTGCAAGTAGTATCTAATGGAA
ACCAAACTCACTGCCAACTCAGTGACCTTATAGGACAGTAGCTCATAGGACAGAGTAGAA
CTGATGCTATGGGCTTCCTAGACTGTAGAAAGCCCCATCAGAAAGTGCTAATAGACCCCA
GACATAAACCATTGTAAAGATCTATGGGGAAAGTTCCCTAATGGACCTTTTGTAATTAGG
GTTCAAACTGCAGCAAAAGCAGTCGGGATCTGATTTGGCGGTCGCTCTCCATCCAGCTCA
TGGGATGCAGCTTGATAATAGAGTGTAAGTGGCAAGGCATGCTGGGTGCTGACTGACCCA
TGCAACAGGACCACCCTGCCCAGTCTTAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2130..2233, 3542..3590
1001..1003, 2130..2233, 3542..3587
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved