Echinops_telfairi Locus ENSETEG00000006854
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000006854
Echinops_telfairi
ENSETEG00000006854
scaffold_318212
SNORD101, SNORD100, SNORA33
1663..1734, 2717..2792, 3060..3193
4338
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGCAAACTTCCGGCCCTCCTCGGCCGCCGTAGCTCAGCTGCT
GTGGACCTGCGCAGGCCCCGCCTCCGGCCGGAGACGGCATCGCGCGGCTGTCTGCGGCGC
GCCTGTTGCGCCGGCCAGTGGCGGGTCGGCCAAGACAGAAGACTCGCGGAACCTCCGGAG
CCCGGCATCGCGAGAGCCACCCCCAGCCTTAGGACCGTGTACACATGCGCGCAGGGGTCC
TGAGTTCCTTAAATACCGTCATGCCCGCCCGCCCGGCCTCTTTCCCTGTCCCCGCCGAGC
TGTGCGGAAGCGGAGGCTCCGGGTGAGGAAGACTCGGGTGGCGGCACCTTCGTAGCGCGA
GTGGCATTTTCTGCCCGAGTGTGAGCAGGGGTGTTTAACCAACGTCTTAATTTTTACCTT
TCAGTGTGTTCAAGATTCGGTCCCACCCGTAACCTACCGCCATGGCCGAGGAAGGGTGAG
TGCGAAAGTGTGGGCGGGGTGCTTTGGCCCACTTCGGCGTCTCCTCCGCTTATCTCTTAT
TTTAAAGCCCCACGCCTGCTGCCAGTGGAGTCGAATCCGACTCACCGAGCCGATAGGACA
GAACTGCCCTTTTGCGTTTACGACAGCTGGATGTCTTGGTAGTTGGCGTGCCTCTTTCCC
GTAAAGCATCCCGTGGTTTCGAACCACAGGCCTTCAGGTTGCAGTTCGGTGCTTAATTCT
CCGCCCATCAGAGTTTGCATAGTGCTAGTTTAACAAATGAACATGCCTGTTTGGGTCAAG
TTGATTCCGACTCAGCGATGTTGTAAGAGGAATGCAGACGGCTTCTCAGGCCGCATAACC
CAGCAGGGGCTCTTTTGAAAAATGCTAACCGATCTGACTTGATTTCAGCATTGCTGCTGG
AGGTGTAATGGACGTTAACACTGCTTTACAAGAGGTGCTGAAGACCGCCCTCATCCACGA
TGGCCTAGCACGTGGAATTCGCGAAGCTGCCAAAGCCTTAGACAAGTACGTTTATGCCTT
TCAATAAATATGTGTGTTGCAATCGGAACAGATACTTAAAGGAAGTAATGAAGTTAATGC
GTTAAGTGCAAAAGAACTCAATATTTGGCGTGTGAACTACAGTGTTTGAATGATGACTTG
TGTTGTCGGATACCCCTTCACTCTCCATGAGTGAGACAAATAGAGTCTGACAAACCTGTA
CTGAGATTGAGCCAGTAAAGGTTTTATCCAATGAAGAGACTTTTCAAGTACCTGTGAAAT
TTGATAGAAACTGGGAAAGATTTTGGAATGTTTAGTCAAGTTCTCTAGCCTGGTTACATT
GGCGAAACAACTGCATGCCTTTAGTTACTAATTGAGCAGATTCTAAGTGTCTGTCAAACG
GTTTTCAAATCAGTTGAATTTATGTCAGTTCAATTCAGTTTGGTGTAGACTGGCAGTTGA
ATCCAGTGGAAACAGCACTCGCTTGTTGGATCTACACCAGCAGGTCCTTGGACCAGTTAT
ACCTGGCAATGCTGCACAAAGTTAAAATCGATGTCTGAGCCAGTAACAGGTAACAACTCT
TTATTTGCTAGCTCATGCTTCACATAATCCATGGTTTTGTGTGTGTAGGAAGTTGATGTG
CAAGAAAAAGCTTGTTCAGCCTGTTAATTCCATATAAACCTAGTTGTGAGAAAGATTGTT
TCTGTAGAAATATATGTCCTGTGGCTGTAAGTCAGAATGCAGTTTTCTGCACATTGTTGT
TATGACCTGCCTCTGCTGCTTGTGTTTTGCCAGTGTAGCCAGTGCAAAGATAACTTGGAA
GGACTATAGGGCCACGGGGTTATTAGTTAGACCCGGGTATTGAAGGAGAATTTTGTATTT
CAGGCGCCAAGCTCATCTTTGTGTGCTCGCATCCAACTGTGATGAGCCTATGTATGTCAA
GTTAGTGGAGGCCCTGTGTGCTGAACACCAAATCAACCTCATTAAGGTAAGAAGCTCCTT
TTAATTTGACAATTTGCAGAAGCATTTATATTGGGCAAACTAAGACTTGGCATGCAAGAA
TTAATGCTGTCCACATTTTGTTCTTAAATGTGTGCCGTTGTAAGAAAATAGTGATTGTGT
CTAAAACTAACAGTAAATATTTTCTAGAAACTAAAAAGGGTCAGAGAGTAAGTAGTAGGT
ATGGGTGACCTTGGTATGCTGTAAATGATGACAACTGGCTCCCTCTACTGAGTCTAGTGA
GGAAATTGCCATGTCACCAATTCTGACTACAGCCACCTTGGAGTAGGGGGTATCTGACTA
CAGCCACCTTGGAGTAGGGGGTATTTATTATTTGAGTTTGCCACCTTCTTAATATAGTGG
TGTTTGATTCCTCCGATAGGTTGATGACAACAAGAAACTAGGAGAGTGGGTGGGCCTTTG
CAAAATTGACCGAGAAGGAAAACCCCGGAAAGTGGTTGGTTGCAGTTGTGTGGTTGTTAA
GGTAAGTTGAGTTAGGGTGAATTAAGATGTGTTGAATTGTTGTCAAGTCTTAAACATTAA
AAGCCAGCCATTGATTCTGCTTACTTGATTGTGTTTCTGCAGAAATTTAGAAAAAGCTGG
CAATAACAGTAAAGCCATGTTACGAGCCTTAAGGATAATTGAGATCATTAAGGTCCCTGA
AAATGGCTACATTAATTTTTATGATGAGACTAAAATAACTAGTTGATACTATCAGTCTAC
ATTGTTCTAAGCAAACTTTTGTTTCTGTTTTTAAAGGACTATGGCAAAGAATCTCAAGCC
AAGGATGTTATTGAAGAATACTTTAAATGCAAAAAATGAGCAAATAAAACTTTGCTAATT
GTTCTCCTGGTTCTAATTATTTTTCTTATTTTTTAAGTGTTATTTTCCATTTTAATTGTC
TATAGGGGACTACTCAGACTAGAAAGCTCTTAAAGTAGGGCATACATCACACCATTGAAG
TTGCAATAGGATCCCATCTCTTCATCAAAGCAAGATACAGTAGAGGTATTCATTTTACCA
CTTTACTGTTTTAAAGCAAACTTGCTTTCATTAAACCTGTGGGTGTAATGAAGGTGGTGG
TAAGGTGGAAGGGGATGTTTTGCAAAAGGTTAAGAACAAACTGGCAACAGGCAATGAAGG
CTGGGGGAGGGAAGGTGGTTTTCCTGTTTTTTAGTGACAGTAGAATAGACTTATGTTAAT
AAATAGCAAAGCTAGTTAAGTTAATTAAGTTAAAAGATTTACTGCTGTGCCTGAGTCCCT
CCACATTACTTAAACCCATCAACTTCTGATTTACTTAAAGGCCATTTTCTAGTGGAAAAC
TCAACTTTACCCTTTTCTAAAAACTGGTTGAGACCCACCTACAAGGCGGGAGTGGGTGGG
TATTAAGTTATTCTGGTAAAGCCTTTTGAGGGGGCTAACCTGAGTCTCATGCTACTGAGC
TGATAAGTAGATCGCAGTTAGGCTCCAATAGCTACTCCTCAGGAGAAAGATGAGGTTTTC
TACTTTAGTTAAACCAGCTTCTGAAACCCATCAGGGCAATTCTACCATGTATAATAGGAT
TCTATAGGGAAGCTATGCTTTTTAATGAAGGCAATGGTGTTGCAGCAGGCTGAGGCTAGC
AAAATCTCTGGATATCAGTATAGAGGGTTAGTGTGAGGCCATAGTCCATTATAACAGACA
AAATGGAGAAGTTTGGTGCGGAAGTAAGGTCATATTGTAAGCCATAAACGGATAGGATAG
GTCTGATAAACCTTTATGCATTTGTATAAGCAGTATACTTGAGTTAAGAACTCATTAAGA
TATATAAAACCTCAGGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1428..1544, 2403..2505, 2899..3000, 3276..3338
1001..1014, 1428..1544, 2403..2505, 2899..3000, 3276..3335
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved