Echinops_telfairi Locus ATG3
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ATG3
Echinops_telfairi
ATG3
scaffold_278901
SNORA42
16186..16322
35367
CTCAAGCAAGTTAACTTGTCCCAAGACGCCCGGTATATCCATTAGGAATGATACAGATC
ACCGATGAAGAGCCAGAGGAGAGATGGGGTTAAAATGCCACTACTGACATTTCCACTAAG
CACTAAGGTCCAGGACACCAAGAAGATAGCGGGCGGCATCGCCAGAAGAAAGTGTCCCTC
TGGAGACGCGTGCGCAGTAGGGAATCACTGGGGCGCGCCCTCCCCTCCCGCAGGCTGTCC
TGTGCTCCCGGGGCGCGGTTACCTCGGTCCCTTCTGGGAGCTTGTAGAGGGGGCGCGCAC
ATCCTAGAGCTGGGAAAATTAAATGCCTAGCATCTCTGTAGCAGCAGTAGAGTTTAGAGT
CCATAAACGGAGATGTCATGGGAGGGAAAGGGGCCAGAAAGCCTCAGCTATCAAGTCACT
TTCCCGGAACTGAAAGCCCGATAAGGTCCTGATGAGGAAAGAGCATGCGCGGAGCCCACG
GCGCAGGCGCATTCGATGTTACGCTTCCGGTGGGCGGGGAAAAGCCGACTGATCCCGCCC
CTTTCTCGCGTCACGTGTCGGGAGCGTCCTATGTCACGTGAGCCCCAGGGGGCGGCAGAG
CTACGGCAAGAGAGTGAGAGAGTCGGGGAAGCCGGAAGAGGCTTGAGGGAAGCCAAGAGG
CGGGTGGAAGACCGCTCCGAAGCGGGCCAGGGGTGCGCGTGCGCCCGCCTCGCCCGCCGC
CTCTCTCCCGCGCCCCGCCGCCCTCCCTCGCGGCCGGGTGACAGCTGGGCCCGGTCCGCC
CGCCGAGCGCAGCCGAGTTCGCCGCGAGCGGGCTCCCGCCCTCGGAGAGCCGGCCGTCCC
TCCCCGTCGTCCTCGCCTTGCCCGTCGGGGGGCGGAGGCGGCCGGGCGCCGGAGCGAGGC
GCCAGCTGCGGGGACACAGTGTGACCGCCCGGTCCCTGTCCCGGGTCCGCCGGCTGCCTT
TCCCCCTCGGTCGCGGGGCCGGCCGCGATTCCGGCCCCAGGATGCAGAATGTGATTAACA
CGGTGAAGGGCAAGGCGCTGGAAGTGGCCGAGTACCTGACCCCTGTGCTCAAGGTAAGCG
GGCCGGCCGGCCCGGGGCCGTCAGGCACGCGCTTCAGTCGGCCCGGGCCGAGGACTGGGC
GCCCGGGGGATGCAAGGACGTCAACTTGTGACTTCTGAAGTCGTTTCAAACTTTCTAAAC
GAGCATTTGGTTATCTTTTCTTTAAAAATGAAATCAGTTCATCTACAATAATGACATGTC
GCCGGCTTGGGTTGTTTTTTTGTTTTTTTTTGCTTTCTAGTTTCATGGGAAGCCTCCATA
AGTATCAAATTTCTCGTCCCAACTTGTTTTAAGTTTCAGAGAAACAAAAGTGAAAATTGT
AATATTATCTCTCTTACCGCCCTTGCTAAGCAGCAAAACCTCGCCTTTCCCAAGCTTTTA
AAACAGTGATAATTAGTTGTTGAACTTAAGTGGCACCAAGGAGTGACTTGACCTTGCTGC
TTGTTGTCCATCTTTATTATGTGGACAACACAACAGTAATGCAGTGCTTTAAAAATATGA
CGTTAGTTACAACAAAGTTGTGCTATTTCAAGAATTAAATTTCTAGAAGTGGATTCATTT
CTTTTTATAACAGATGCAAACATTTTTTTGTGTGTTTTATATTGATAGGCTTATTTGCCT
TTCTGACAAAGTGAAGGAAATGGATGGCAAAATTTTGCTTTATTTTTTAAGTTTAGTTTT
TGGTTAAAACTTCAGAATTGTTTAAAATGTGGAGATCAAATATTGGAAAGTTGGTTTTCT
TTATTCAAGAAGCTAGGCCAGTATGCTAACAATAGTAGACAGTTTTTCCTTTCCTGCTGC
CCTATTCTTTAGCATACTTGGCATTTCTAAGACTGATTTTCAAATAATCCCCTTACTTGA
CATGTTTCAAAAAGTATATGATTGAGAATTCCAATTCTTGTATAGTTTATATTTTGTTTT
CTGTGAGACCCATCTTATTTAAGATTATTCTGTAAGCTACTTAAAGTTGAAAATTATTTT
GACTTTTGAACAATGTGTTTGTGTGAAGTGTCTACCTTTTCAGAATAGTACCTCTACATA
AATACCAAAATTTAATTAATTATACGTATTCCATTTCTTAGTTCCAGAAGAGAGGGAACA
AGAATAAAACCCCTTACATTTAAAAAGGTGAAAGGCGAACTTAATATGGAAATATTCATT
GGTGTCCTTTTTTAAATCAGGAAGCGGAGCAATGACCCCGTTACTTTTCCCTCCTTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTTACAGAAAGAATCCTTTTC
TGCTAGAGGTGAGAATGCAAAACAAAATATTCAGGAAAGAAGTAATGGCCGCCTTAAACC
CCCAAACCACAGCTACTGTCAACGGAGTCAAAACTCCCCTCCTGCTTTGAGTTTCTGAAG
CTGTAAATCTTTATGGGAGCAGAAAGCTTGGTCTTTCTCCTGAGAAACTGCTTGAGTAAG
TTTGAACTCCCAACCTTGCTCTTAGCAGCTGACACTCAAACCACTGTACCACCTCACTCT
GCTCACTGCCGTCAAGTCAATGCTGACTCATAGCGGCCCCTCAGAGTTGCTGGTAGTTTT
GAACTGTCAACCATCAAGCTCACAGCCCAACACTTAAATCTCTACATGCGCAGTGCTCCA
TCTAGGACTCTCATGACCTCCTAGCAAGTAAAAGGAGCCGTGGGTATAGTGGGCTATGTG
TTGGCTGTTAACTGCACACACACCTAGCAGGTAGACGCCATCGCCTCCTTGGCTGTATGA
CAAAGGAAACAAGTTAAAATGAAGGATTTCTTTTATTTCCTTTTTTTCTGAAGACCATAG
TAAGAGCCAAAAGCCCACGTTCTCAAGATGATCATCATAATCCTCACAAACCCCATTCGC
ATATCTGGTCGTTGTTCACTCTTGTTTAAGCCATGCGGATCCTCTGTGTTACTGTCATAC
AGATTTTGCCTAGGGGTATTTTCTTTTGCTCTTACTTCAAGTTGTGGGTTCCTTCTTGGG
CTACAAGGTCAGCAGCTTGAAACCACCAGGTGGTGCTTGGGAGAAAGGTGAGGTTTTCTA
CTGTCAAGATTTACAGGCTGGGAAACCCACAGTTGTAGTTCTGCCCTGTTCTGTAGGCTT
GCTTTGAGTCGAGATGGACTCAGTGGCAGTGGATATCTTCATCCCTTCTCTCGCTGCTCT
CTGCTTTATTTTTCTCGATGGCATTCTGTGTTTAATATATTTTTCCCTCCTCCAGAAGTT
AAATTCCCTGTGAGGGAAAGAATGAATTTTATCTGTTTTACTCAATGCTGTATGCCCAGG
TCTTAGACTGGCACACTGTGATACTACATTTAAATGGATCATATTCTTAAGATGAATTTT
TTTGTTTTTTTTGTAAACTATCACAATTTATATATGACTTAAAATGTAGAAAAATATTAG
TAAAATAACATTCTGACATTAGAGGAAAGAATTTACAAAATTTTCACTCTTGTAAAATAA
GATCAGAATTACCATAAGGTGTGACATAGTGCAAGTCGGGCTGCCATCCACAAAGTGGCC
AGTTCGAAACCACCAGCACTCCTCAGGAGAAAGACAGGGCTTTCTAGTCCCATAAACAGT
TACTGCCTTGGAAACCCCCGGGGGTAGTTCTACCTTGACCTGTAGGGTTGCTCTGAGTCA
GTATGACTCAGGGACAGTGAGTTTGGTTTGGTCATGTTTGTATAAACCTTTGAATTCTTT
CCCAAAACACTGGTTCTGTTACAAAACACAACCAAATCCACTGCCATCAAGTCGACTGCG
GCTCACTAGTGAACCTAAAGTGCCTTATAAGACAGCCGAATTGCCCTTGTTTATAAGACT
GAATATTTTTGGAAGCAGGAAGCCTCATCTTCCTCCCACAGAAGGGCTTGTGGCTTTATA
CCTATCACCTTGCTCCACCACACCACCAATGCTCTTTTGTTGTAACACCTTATTATAATT
GTTTTCATGTCCGTTTCACCTATTAGATTTGTTTATTCCTTGAGATCAGATTCATTTATT
TATTTTTTGTCTGCCTCATATGCCAGGCAAATAGTTGCTCCACAGATGTTTTTTATTTAA
ATGAATAAAAAGTAGAAATTTATGTGACTCACTTATTCTTTTTTTAATTTTAGGAATCAA
AGTTTAAAGAAACAGGAGCTATCAACCCAGAAGAGGTAATTGTTGGATAGATTTTAAGGT
TATTAAATTTAGAGAAATAATTATTATATTAAAACCCTGCATTTTCTGCTTTGTAAGAAA
AGCTTTTGAATGTCGCAATTTTAAGTAAAACTGGATTCTATTTACCATATTTAGGAACTT
TAAACAATGTACTACTTGCTATAAAAGGAAAGGTTACTTCCCTCTTGATTTGCCACTTCT
CCCATTGCTCTGTACTTCCTCTGTATTTAGAAATAAGGGTGGTGGAGGCATGGCCAAGAT
TCCCATGGCCACTTACCCTCCGCTCATCTCTGTCAGATTAGTCTGTGCAGTGGGCACTGT
GATGTTCGCAGACTTGACTCTTTGCCCCAAATGGGTTTTCATGGCTTTCTGGTTGTAAAC
TCCACCCACTGGTGGGACATTCAGTGTTTTTCTTAGTATTCAGGTTATATGGTTTTTTGT
AACATACTTAACACTGATTCTTTTCTCCCAGTCTAATTTTCTATAAACTAGGTTATTTTG
AAACTGCTTAGTGTTGGAAATAACAGCTATGTTATTGGCTAGTTGTATTTTTTTTTTAAA
CTTCTAACAAGACAAAGAGTTCTCTTTAATTCAGATAATTTCACTTTGTTTTCCATGAAA
AAAAATGGAGAAAAAAATTGATTCAGAATCCTGGGCTACAATATCTTTTTAGAATCTGGT
ATTTATTATAAGTATCTAAGTTTGTATCAGACTTATTTTTGTTCTTAAAAAATGGAACAG
AATTTATTTGAGGTTAATTTAAGCTCTCACTGAAAACACCACTCTTTGGTAATAGAGCTT
AATTCATTATTTTGAAAGAAAAAATTTACAATACGGCACACAATAGGATCTTACTGCTGC
TGTAAATTCCAAGACCGCAAGCCAGTGAATTAACTGGTCTTTCAATTTCCGATTGTGATG
AAATAGTGGTTTATGTGTTGAGTCGCAAACCACAAAGTCAGTCGTTCGAAACCACCAGCC
AATCTGTGGACGAAAGATACTAGCATGAAGAGTTACACTCAGAAACCTGCAGGGGTCTAG
TCTGTCCTATAGGGTAGTGCTATGAGTCAGAATTGACTCAATGGCAGTGAATTTTTTTGG
TTTTAGAAATCCAAGTGAATTCTAAGAAAATTTTGCTAAACAAAACCAGTCCAGATGGGT
ACCAAGCACATATAAAATGATCCTTGATTTTAGTAAAGGCACATAATGGTGTAGAAAGAA
CCTGGAAGACTTGACTTTAGATCAGCGGTTCTTAAACTGTGGGTCGCAACCCCTTTGGGG
GGTCGAACCACCCTTTCACAGAGGTCGCCTGATTCATAACAGTAGCAAAATTACAGTTAT
GAAGTAGCAATGAAATTAAATTTGTGGTTGGGGGCCCACCACAACATGAGGAACTGTATC
AAAGGGTCGCGGCATTAGGAAGGTTGAGACCATTGCTTTAGGTGAACTTCTTTTATTTTT
CTTGTTCTCACTTGGGCAATGGTAAGTTGTCCAGGCTTAGGCCAGCTTCCTCATCTAAAA
TGTGAGATTTGGCCTAAATATTCTACTTATCGTAGTTATCTAGTGCTTCAGTAACACAAA
TGCCATAAGTTTGTGGATTAAAGGAACAGAAATCTATTTTCTCCTAGTCTTGAGGATTCA
AGTCCAGGATCACAATCCTGGTCCCATGGATGCCATACATTCAGTCTTCCCCAGTAAGTG
CATGCCTGTCTGTGTGCTGTTTTACTCTGTATAGAAAGAACTAGAGCCACCCTTCATTGG
GAGAGCTTCCACAGATGCATGGATTACATTATGGGAGGTCAGGGATAGAGGTTAGGTTTC
CAACAGATATTGTGGAGATAGTTTAGGCTTCATGAGTTCAGTGCCTTTAGTGCTCATGAA
ACTGGCATTGGATCTGAAGGAAATGAAAATTCTTGCCAAACAAAGCTGTAATGGAGACAG
GGCTTTTGGAACTGCCGTTGCTAGGTGTCTCGAGTCACTTCTGACGCATGCTACCACGTG
CACAACAGTGAAACCCTGCCTGCCTGTACCATCTTCCCCGCTGTGCTTCCACTGCTGCAG
CCAGTGTCAGTCCGTTTGGTTAAAGGCCTTCCTCTTTCTCACGGTCATTCTACCAAACAT
GACGTCTTTCTTCGGGACTGGTCTCTTCTGAGAACATGTCCAAAGTACATCAGACAAAGT
TTCTCTATCTTTTCCTCTACTGTGCAGTCTGGCTGTACTTCTTCCAAGATGTTTGGTCTT
TAGGCAGTCCATGGAACTTTCAGTATTCTTCACCAGCACCATAATTCAAGTGCATTAATT
CTTCTTTAGTCTTCCTTATTCAACAATCAAATTTCACATGCATATGAGGCAATTGAAAGT
ACTGTGGCTTGGGTCAGGCACACCCTAGTCCTCAAAGTAACATCCTTGCTTTTCAGAACT
TTAAAGAGGTCTTGTGCAGCAGATTTACCCAATGCAATATGTCATTTGATCTCTTGACTG
CTGTTTCCATGAGCAGTGGATTGACTGTGGATCCAAGCGAGACAAATCCTTGACAACTTC
AACCTTTTGTCCATTTCTCATGATGTTACCTATTGGCCTAGTTGTGAAGATTTGGTTTTC
TTTACATTGAGTTGTAATTCATACTCAAGGCTTCAATCCCCGATCTTCATCAGCAATTAC
TTTTAAGTCCTCTGCACATTAAGCAAGATTGTGTCATTTGCATATAGTGGGTAGTTAATA
AGCCTTTTTCACTCCTGATGCCACATTCTTATAATCCAGCTTATTTGCTTAGTTTATTTG
CTTATTTGCTTAGCTTAGCATACAGATTGAATAAGTATAGTGAGAGGATATAACCCTGAG
GAAGCACACCTTTCCTGACTTGAAACCATGTGTAGTATTCCTTTGTCTTATTCAAACAGC
TGCTTCGTGGTCCATATACAAGTTCTGTATGAGCATGATGACGTGTTTTGGAGTTCCCGT
TCTTCTCAAGGTCATCCATAGTTTAAGATCTACTCGGTCAATTGCCTTTGCATTGTCAAT
AAAACACAAGTACAGTGAACCCTCGCCACTTCGCGCCTCGACTTCCGCGTCTTCACTCTA
TCGCGGTTTTTGCGTAATAGCGCATGCTCTGTCATTACTGCCACTGATTGGCTCATACTG
TACACGCTTGATGCCATAAATAATATAATAAATAATAAATGATAATTGTAATGTCCAAAA
TGTTTTACTGTATTTTCCCTTTTTCGTTTAATAAATTGGGTAATACGAGTGTAATGGTGA
CTAAAGGGTGTTTTTTCATGTCCTCTATGCTCTAACTACGAAAATATTTGATTTACAAAT
AAGGAATCCTACTTCGTGGAATTTCATTTATCACGGTAGGGTCTAGAACCGATTAACCGC
GATAAACGAGGGTTCACTGTAATCGTCTTTCTGGTATTCTCTACGTTCAACCAAGACCCA
TCTCGCATCAGCTGTGATATCCTTTGTTCCATGTCCTCTTCTCAATCTAACCTGAACCTC
TGGAAGCTCCTGCCATGGTACTGCTACAACCATTATTGGATGATCTTAAAATTTACTTGT
ATGTGCTATTATTGGTATTGTTCTATAATTTGATCATTCTGTTGGGTCACCTTTCTTTGG
AATGGGTACAAATATGATCTCTTCCATTCAGTTGGCCAGGTAGCTTTTATCCAGATTTCC
TGGCATAGATGAATGAGTGCTTTCGGTGCTTCATCAGCTTGTTGAAACATTTCGATTGTT
ATTCCATCAATTTCTGGAGCTTTGTTTTTGGCTAATGCATTCAGTGGAGCTTGAACTTCT
TCCTTTACTACTGTTGGTTCTTGCGCAGATACTACCTCCTGATATGGTGGGATGTCTATT
AGTTTGTTTTGTATAATGACTGTATTCTTTCTATTTTCTTTTGATGCTTAATTTTGACCC
TAGAGTCTTTCAGTATTACAACTCAAGGCTTGATTCTTTCATTTTCAAATATGCTGAGTG
AGTTCTCTATTGGTTTCCTAACTCTAGGTCTTTACATATGTCATTATAATATAATAATTT
ATTTTCGAAAGCTGCTCTTTGAAATTTTCTGTTCAACTCTTTGATGTCATCATTTTTTCC
ACCTGGCTTAGCTACTCTACGATTATAAGCAAATTTCAGAGTCTCTTTTGATAGCTACTT
TAATCTTTTCTTTTTCCTTCTCTCTTTAATGACCTTTTGCTTTCATGAATGATGTTCTTG
ATGTCATTCCACAGCTTATCTTCTGTCATTTGTGGGCAGTGCAGCAAATCTGTTACTGAG
GTGTTCTTGATATTTAGGTGGGTTAGGCTCAAGGTTGTGTTTTGGTTCTCATGGATTCGT
TTTCATTTTCTTCAGCATCCACCTGGACTTACATAGGAACAATTGATGGTCTGTTCCACA
AGTCAGCCCTTTGGCCTGGCTTTAGCTGCTGATGTTGAGCTGCTCTATCATGTCGTCCCA
CAGATGTAGTCAGTTTGATTTCTGTGTGTTCCATCTGGGGAAGTCCGTGTGTAGAGTCGC
CATTTGAGTTGTTGAAAAAGATATTTGCTATAAAAAAAGTTGGTCTTGCAAAATTCTATC
TTGCAATTTCCAGTTTCATTTCTACCACCAATACCATATTTTCCAACTACTTTTCCTTCC
TCTTTGTTTGAAACTTTTGCATTACCAGTAATTATCAGTACATCTTGATTGCATATTTGA
TTAATTTAGACTAAAAATGGTGTTAGAATTCTTCAATTTCTTCAGCACTAACTAGTGGTT
GATGCATAAATTTGAATAATAGTTGTATTGATTGGATTTCCTTGAAGGTTGATAGGTATA
ATCCTAGTACAGTCATTTTTTTTCAAGATACATCATGAACATGTCCCTTTTTGACAATGA
GTGCAATGCCTTTCCTCTTGATTGTGCCTTTTCCAGCATAGTAAACCGTCTAATGTTCTG
GTTCAGATTGGCAACACTAATTTAGCATTAGCTCACTAATGCTTGGGATATTGATTTTTA
TGTGTTATATTTTTTACTTCCAATTTTCATAGATTCATACTTTGTACATTCCAAGTTCTT
ATTAGATTTTTGCAGCCATTTCTTCTCGTTTTCAATTTTGCCCCATCAGGAAATGAGGTC
AAGAAGACTTTACTCTCACATGGACTTTATTCCATGACTCTACTTTGAAAATGTAGCTCC
GCCTCAGTCATATTTGAGCTTTCTGACCCGAGGCACTCATTTATGACATTATCTCGGACA
ATGTTCTACTTCTGTTTCGTAGACTCTCAGTATGTGACAATGTTTTGATTAGCCATAATA
TTTTCAGCAGCTATCCTATAAAGTGGACAGCTGATTCCTTCTTTGTAGTCTGTTCTTAGT
CTGGAAACTGCTGTTCACTTTGGGTGACCCTGCTGGCATTTGCAATATCAGTGACATAGC
TTCCAGCATCACAGCAATACACAAGCCACCACAGTACAACAAACGGACAGACAAGTAGTG
GACTCTTAAAACTAAGCATCTGAAATCAAGAGCAGAGATGACAGTGTTCTGTTCTTATAT
CCTTAGATCGTAGATTCCCAAACTTATTTGGCCTACTTTCCCCTTTTCAGGGAAAAACAA
CAAAACTCATCCCTTCAGTAATGAAAACTTTTGTACTATAGCTCATAATCCAGGATAAAG
TATTAGGTATCTTCCATCAACCTGATACCTGGATCATTCCAGTGTCCCCCATGGTACGGT
ATCCCCCACTTTTGGAAACACTGGCTTGGACTTTATGCCCTCTGTGGAGATGTCTAATTG
ATAAATAGTTGAAGTTAAATATGAAGCTGTGTATGGTCATTGGATAAAAAGTTAACTTTT
AAAACCGGCATTAATCTAATAGTGTTTTAACTAGCTAGAAATAAAGGAAAGCTGGTGGAA
TCGTGGGCTAAGCTTTGGGCTGTTAACGTATAGGTCAGGGGCTGCTTTGTGGGAGAAAAA
TGAGTCAGTCAACTTGATGGCAGTGGGTATTAGCTAAAACTGCGTTCATGTGGGATGTGT
GTATGGCTTGATTAAGGAGAGTACTATTCATAGAAGGCAGCTTGAGAAATAGTTGCTCAC
CAAATTTTTAATATCACTTATCTTGATGGAGGTACTCATTTTATATATGAAGGGGGGATA
AAAATTAGTGGGGAAATGGAATTAAAAGGAAATTTTCTACGAGGTTTTTGAAGCCCCTTC
TGTTTGATGATAAATCTCACAAGAGAATATTTAATTACTGAGTAAAAGCTGTTGTAAGCA
ATATTGATAATGTAGAAATTTGAGTCCATTTCTATCTTACATTTAGCTTATTTGAACATA
AACAAGTAGTAGTCGTTGTAAATTGTTAATGAGGATAGATGGGCGCTTGTGCAATTCCTT
TCTCTTAGGGTTTTTTTATTATCTTTTGGTAGTTTTAATTTTTTTTAATGCCATCAGGCA
TGAGGAGGGGGAAGTATTGGGATCTTAGGACTTTGAGGAAGTATCTTTAACTTTGAGGAA
TTTTTACTTTTTTGCTATGCTTTTACTGTTGGTGGTGGTAAATTAGTTTATTGTAACAGC
AGTGGTAATTGTAGCAGCTGGTTGCAGTAAATCTAAAATGCTTCAAACTTGGGAAAGAGC
ATTTTTGCTTTTTGTTTTACCTCACCAGTTTAAATAATAAAGCTTATTAAAAGAACAAAC
ACAAAGTTGCTGTTGGAAATACTACTATCGGTCTTACAATATTGCTAAATCTTAACCCTG
TTGATGTATTATTCTAAAAGAGGTTATTCTCAGAGTTTGTATTTGATAGACTTACTTTCT
GAAATTGCTAATGTGTAAAGACATGCTTTTTCCTGAGAGGCATTAGAAGATTAAAGATAC
TACAACACTTTTGCTGTGGAATAAACTCATGAACAAAATAAAGCAAGGGAAGTGAGAGTT
GTTATGAAATACAAATAATTGGGAAAGTATGTGTGCACTTTACTTGAATTGGGACATTGA
AAATTATGTTTAACAGGCTTTTACTTTCTGCTCTCAAGAATAAACTGAGTTGCTGTCCGC
AGATAAAGCTAGCTCTTGCCTAATTCTCAAAACGGGACACTATTCCTACCTCAATCTGTT
GATGTTGGTTTTTTTGCTGTTGTTGGAGCAAAACAAAAAAAGGCTTGTTTGCTTAGTCAA
TTTCTTAATTAGCCAGATATTTTAAAAATCATCCCCGAAGTTTTTTTCTGCCTTCTTTGG
CACTACATTTCTCTGTTTTGAATGGTTCCTTTAAGACTGAAAGAAGCTTTAAAATTGGCC
ATTATCTAAATTAAGGGGAAACGAGGAGAAAAAGTATCATGCATTGTGATCTAATCAGGT
AACCTTACATTAGAGGCTTGTTTAAGTTTGACAACTTAAACTTTTTTTCAGAAGTTTTCA
CCCAGTAGCAAGAGTCTCTCTACATTTTATTTGTAGAGTCCTGTAGCCTTGTCTTCATTG
ATTGTATGATACTCTATGCTATTAGCATTATTTATCTACCGATAAAAATAACATATTTAA
AATATAACAGTAAGACTTGTTTTCTTTCAAGAGTTACTTGAATTTGTATGAATATTAAGA
ATGTAGCTCTCACAATAATCAAAAATAACTTTTCAGACAAATAAATTAGGTTTAACGCTG
TTTAAAATCTAGTTTAAGATCTGACCAAAGTTTTGTAGAGTGATTGGTTTGGTATCTTAC
CATGCTACATGTAGTGATGCGTAACTTTTCTTTTCAAACCCTGACTAGTTTGTGGCCGCT
GGAGATCATTTAGTCCACCACTGTCCAACATGGCAATGGTAAGTACACTTGAGTAGACAC
AAAAGGAAACAAGTATGGCTGCAGCCCCTCCTGGGTGCCTTCTGCTGAGGCTTATGTGGG
GGAGTGACATGTCCCAAAGAGCTTTGTTAACATTACCANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAGAAC
TAATAAGGTTCTAATTGATGTTTTTAAATATTTAAAAATCTTAAATAATTAAATCATTTT
AAACCAGAATTAGCACTCTTTTCTGTCTGTGGTCTTTTATTTCCCTTAGTTTTTATATTT
AACTTATACCCAAGACAGTTGTTCCTGCTTTTAATCATTTTTAATTTTCTAGGGTGTGGT
AGGCCAGGTTAACTAAAGAATCAAATCCTGAGCCACTCAAATGTGTAAGAAAGAGCTTTA
TTTCAAGAAGTAATTGTGTATCAAGCAAACATCCTAGCCCAGTCCAGATCAATCCATAAG
TCCAATATTAGTCCATAAATCCCTCTTCTGACTTACGCAGCCACATGGAATGATGCAGAA
TTCAGGAAGATCACAGGTCAGGCAGGTGGATGCAAAGTCCTGTGAATCCAATGGCAGTGA
CTGTATCTCCAGGGCTCTGGCAGCAATCTAGGTCAGCCAGCAGGAAAGGTGAATGCAGGG
AGAGGGGAAGGTTCCCAGCACCCTCTTTATGAGAAGGCCACGCCCACAAGGAGTCACCAT
CAGGTTGTGACCTGATTGACAGGCTGGACTCCACTACACTCTTCTATATCTTCAAGTTGA
CATGAAATTATGTAACTACCACATAGGGCATTGATATTTATGTATCATTAAAAGCTAAAA
TGGCAGGTGTATTATTACATCCTTTTCCCCCTTCTGTGTTTCTCAGTACCATATTTAAAA
CAGATTGTATTGTATACGCTCCCTGATTTTAGTAAGGGTTGTTGCTTTACCCACCACCCA
CCCCACCCTATCTAAATTGTTTGTTAAAAATGTATATACTGAATTTTGATCTTAATTTAG
ATATATGCGAAGTCAAAATGTATATACTGAATTCTGATCTTAATTTAGATATATATGAAG
TGAAATAGATATGGAAAACAGATTAATTTTGTAAAAACTGAACTAATTTAAGATTTTCTT
GATAACTATTATTTCTATGATACAATGTCATATGTATTGATAAGTATACACTTATGATAT
ACATTTTGCATATTCTGATTCCTTTGTTAAATCCCATAATTATTTGGTTAGCTTAGACAT
GATTTATGGCATTGTGTACACATGTGGTCAGGATCTTTTAAAGTAGACATTCAGAGTTTA
TGAATTGTGCAGCTTGAAATCATTTTACTATAATTTAGAACTCATTTAAATCTTACTCCA
GTGCCTGTTCTTTTGGCTGCCTTATGGATCCAAAGGAATAATCCATTTCAAGTCCGCGGT
AGAAACAAGTTCTTGCCATGCCATGCTTTCCTGTGTACAAGGCCCAGAACCCTAAAGAAC
ATCCTCTCAGTGCCTATAGCATTTGCTTGACCGTGAGGAATGACTTGGGAATGGCCTAAA
GCAACCCACAGGGCTGCCAAATCATAATGGAGAATTTCGTGGTTTATCTTGTGCTTAAAA
CCTGTCTGTGGACTGAAGTTTAAGAAGGTAACAGCACTAAATTTATGCTTTTATATTTGT
GTGACAGGCACCAGATGCCACCCTAGATCTGGCTAGTTCTAATAGAGTTAACAGAAAAAT
CTTTGAACAAATGCTTCCTGAGGGATTCCAGGGTATCCTAGAAGAGTGGGAAGCATTGTT
ACTGGCTTTGGCCCACAGAGGGAGTAGTGGTCAAGGGCAGTACCCTGGGGTCTCTGGCTT
CCTCCTGGTGGTTCCACCGTTTGGTTTTGTGACCCTGGGCAATTTGACTTTATTAAGCTT
TTGTTTACTTAACTGTAAAGTGGGGATATTAATATTAGCTAGTTTTTATTAGGATTAAAA
TTTTAAAATACAGATTAAAATTTTAATTTGTGACACTTAAGTATTCAGTAAAAGTTTGTT
TTTAGTCATCATTCTCAACATTATCATTTTGTGATTCAAAGGATCTCGTATCCCTGAGTT
CTGATTTTCATACAGTTATAGGAATGGGATCTTGCCAACAACCTACTTTGTTATGTAATG
TAATGCAGCATTTTTTCCTGCCTCTTGGCTTGAAGATGAGCATTGCTTTAGGACTGAAAA
TATGAATGAGCATATACACACTAGGGAATGGAATTTTTTTATTTGCAGACAAATATAATA
CTTGTTCAATCTATATTATTCTAACCCCTTTGTCTAATATCAAATTATCTTAGAGCTACA
TATTTTAGTGCATTTAGCTTTTAAAGGTGAATTATGCTTTTCAGTGCTCTGAGCCAAAAT
ATGCCGAGTCAATCATTAAATGACATTCTATCCAAAATAGTAGTAAAATAGTTTTCTTGG
AAGTATGATGTAGATTTTGTTTTCTTTTTAACATTTTACTGTAGTTTGCATAAAATTTAA
CAGAGCAAATCATCAGTGTTCCATTCAGCAATTTATACACATTTTGTTTCATGACATTTT
CAAATCCTCAGTGTAACAGTGCTCTGTCCACTTCTTCCCTGGGCCTTTGTCCATGACCCT
CCTTTCCTGCCCCTTCCAGTGTCTGAACATTCTTTTTGGCAAATGCTAAGCCAAGTTGGG
TAGTTTTGAGACTTAGATGTGATGATATCTTCATTCCGTATTACCTTCTAAAAGTTTGTG
TCTCTGTGTACCTTTTATTGTTTCCAAAGGGCTACAGGGGAAGAATCCAAAGTGAAGGCC
TACTTACCAAAAGGCAAACAATTTTTGGTAACCAAAAATGGTAAGAATTCTGTTGTACAC
ATTAGAGAATGGTTAACAGTTTTGTTTAAAACAAAAACACAACATTTTAACATTTAATGG
TCTTAATCTGTACTTAAAACTGTGTTTACAGATTGTGGTTCTCAGATAACAATTTAGAAA
TTTAATGAAACCCTGTATTTTCTGTTGCTGGGGTTTTTGTTTTGTTTTTTTCCCATTTAA
CTTTTATCTCCCTCAGCTCCTCTTCCACCAACCCACCCCCCCAAAAAAACCCAAGCATCT
AATATAATTGGAAGAAGAGAGCTCAAAGCACAAAGTTGACCTTTGTCTAATTGGATTTTT
TTTTTAGTTGATGTCATAATCTGTTTAGATACTTGATGTTAATTTTTCATAGGTATACAT
TCTTCATGAAAAGATGAAATTGATGGGCCTCTCATAGTGTCCCGTGCCAGAGTGAACTGT
AACCCCGAACCATTCCCTGGCTCTATCCCATGGGCGTTGGGCACTAAAGTGGGTTGCACA
GTGGAAAAAAGAAAAGAAAAGATGAACTTGATAACTACGTTATACATGTAAAATCTCCAA
AATAAAGATTATATTTTTCATTTTGTCATTGAAAATGAAATTTCGCTCTCTCTGCCATTG
AGTCATACTAACGTGTAGCGATCCTATAGGACCAGGTAGAACTGTTCTGGGAATTTCTGA
GACTGTAACTCTTTACAGGAATAGAAAGTCCCATCATTCTCCCTTGGAGCAACTGGTGGT
TTGGAACTACTAACCTTTTGGATTGCAACCCAACTCATAACCTTTAAGCCACCTGGGCTG
CTCTGAAGGATTTCTTATAGTCACACAAATATTTTTGAAACAGGCACTGTTTTTATAAAC
TTGATTTGAAAGCACCAAATGTTATCATAATCCTCATTTAATAGCAAAGCAGTACATTGA
TTTCTCTTCAAATATAACCGGTATAGAAAGGGAAAGCAATTATGTATGAGACACAAATTT
TTCTTACTTTTGCATATTTTTTCTATTGCAGTGATAATATATACCTTCCAATGTTAAAAA
AGAAAAAATCAGATTTGTTAATCCTTTGTTAGGTGCTTTTACTTTGCAGTTTCTCAGTGT
TAGGATTATAAAAACTGACACCTGTTCATTGCCTTGGCAGCAGTATTGTCTGAAAGAATA
AAACTCAGCTGTTAGGGGACTTTAAGGCACTCTTTTATGAAAACTGGAACTTAAATGATG
AATTTTACATTGAACGTTCCTTCAGCTTTGCAAACAGGAGGTCACTTGTTCCCTCCCTCC
TTGGGCATGACAGGTGGTGCCTCCCTGTTGTGAGTGTAAGACCATTGAAAGAAGGTATGA
TTCCTAAGCCAGGGGTTGGATAACACCACCTCTGACCTCAGCCTGGGTTCTCACAGACTG
TCAGGTAAGGAAGGTATTGAACACTCGGAGCAGACCATTTTCTCCTGTCTTCTGACACGG
ATACTTTGGGGAACATTAATGTAACTGAATAATTAAGTGTCTGCACTGAATACTACTATA
AATCACTTTCATTAGAAATGAAATGTATTGATGCAGTTATAGCTTTGTAGGATGAAACTA
TGAAAAACTAATGGACTTATGATTAGCATGGCTTATGCTGTAACTATATTTGCCATTTTT
TAATAGTGCCATGTTATAAGCGGTGCAAACAGATGGAGTATTCAGATGAATTGGAAGCTA
TCATTGAAGAAGATGATGGTGATGGGGGGATGGGTAGATACATATCACAACGGCAGGTAA
GAGGAGACCAGGGATGCTATATATGCAATTTTTAATTGTCTTAAAGTCTTTAGTAAAAAG
CGTTGCTCAAACAGAGGGGGCATGGCCTGTGCAGTTTTGTCCCCTGTAACTTTCATCTGA
GGGAAGTAGGGGGACATATTGGCAAAATAAAATATGCAAGATTTCTGTAATTCTTCAATT
GTAGTTTGAAAATATCCATATTTTTGTATTTCTAAATAAAGAAGAAATAAAGCGAATCAG
AAATACTGAGTGTGCGTTCTGTATAACTGTAGAGTCCCTTGGTTATATGTCATTCTTCTA
CTGGAACATGAGCTCCTTGAGGCTAAGAAATGTATCCTATTAACATTTACTTTATCCAGA
TAACACAATTAAAATACCCGGCATTGAACAGTACTTAATACTTATTGAGTGCTTATTAAA
AGATATTAAATACTGTAAGCTCCATGAAGGCAGAGATTGTTGAATTCTCAATATATCATA
GTTCCTGTTATAGAATTTGTTAAGTAAGTGTTAGAGCATATTGACTGAATGTAAAGCCTT
TCGTAAGCATTTGTTTACAAATGTAACTGTAAGTGCTTAATGTTGCATGAAGAAAGTATG
TTCAGCGTTTATATCTTGGCTATTGGAAGCAAGTTTTCCTCTTAAGTTATCTAGACTAGG
TGATACAAGTATTTAAAGCAGTTGTAAGGAAGGGCTTCTCACTTTGGTCCAGTTGTCACT
TTGGACCAGATAATGCTATGTGGTGGGAGGCTTTCTCAGGCATTGTAGAATGCCGATCTT
TCTCTGACCTCTGCACACTGGATGCCAGTAGCAGCATCCCAGTAAAACAGGGCTAAGTGA
TATATATAGTACAAAGTACCTCTTTAGGTCTGTTTCTCTTCTATTTGGACAAGGACGCTG
CCAGGTATTTTCATATGGACAGAAGGCCCAGATTCAGAACTTTTATCTAGTTGTTTTAAC
ATAGCTTGGGCCTCTGGCTCTGGATCTGAAATATGTGGTTTTAATGAGTGTGACTGTTGC
TGTGTCAAGAACTACAGGAGATAACAAATTCAACAAATTATCAAAATAATTCCTATCTTC
CTTCCTTCCACTGAGTAGTGTGCTCTTAGACCGTGACTTCTATCCTCCTCCAAAATCGTT
CAGCTGCTTGCTGTAATTTTCCCATGAAATTTTCTGGAAGGTGTAAGCAGTACATTTTTA
GTAAAATTGTCTGCTGACTGGCTACGAGCCATTGGTTACAGTACTATGTTTCTAATGTTA
AGTTAATGAGTTACTACTTCATCTACTTGTAACTCATTCCATAAAAAATCTCCCAAATCC
AGGAACATATTTAAAATGTCTTTATAGAAATCTATGAGAAATTGAATGAACAACACAGGT
TTTCCTTATTGACACGAGAAAAATAGTACTTTCATATATGGAAAACCACATAGCATTATA
CTGCAGCTTACATGATATATGGACCCCTGGTGGCATCATAGTTGTAGGTTGGGCTGTGAT
CTGCAAGGTGAGCAGTTCTAAACCAGCAGGAGCTCTGAGAAAGACTGGGCTTTACTAATG
TAAACAGTTATAGCTTTGGAGACTCAAGGGGCAGTTGTTTTACCCTGTCCTGTGGGGTGG
CTATGAGTCGGCATTGACTCTGGGAGTAAGTAAAAAAAAAACCTGATTTATATAGTAAAT
TATAACTAATATTTATGAGAGATCTATAAAATCTTAGGTTTAAGCTAGTGGTTCTCATCC
TGTGGGTCATGCATGACCCCTTTGGGGGTAGAGTGACCCTTTCACAGGGGTCACCCAATT
CATAACAGTAGCAAAATGACAGTTATGAAGTAGCAATGAAAATAATTTTATGGTTGGGGG
GGTCACCACAACATGAACTGTATTAAAGGGTCACAGCATTAGGAGGGTTGAGAACCACTG
GTTTAAGCTATATTCCAATGTAATTGTAGCAGTTCCTCCAATTGAATCAAAAGACTCTTA
GATGCCTTGCTTTATCCCTGCTTCTCTCCTTAGCTGCTTTTTCCTTTAGTCCCTCAGTGG
TGTTCCTTTCATTAGATAAGGGGAGCTTTTCTTTGCCACTTGTGTCCTACTTTTAGAGCA
GTCTGATTTAATGGGACATTAGTATATTTTAACAGATGAGAGAGGTCCATATTCTTTGTT
TCTTTGTGTAGGATTTCAGTGAATCATTTTGTGATATCAATTGGCTATGTTAAATAATTA
GGTTTAACAATTATACTGTTATCCATACTTACACAATAATTTCTAGCAAAACTTAAGAGC
TAACTGCTTTGAACAAGAACCATTGGATTGACATCTTCCAGTTGTAAAACTGAGCTAATC
ATTCCTTAGTTTGGGCATGTTGGATGTATAATTTCAAGGTTTTAGAAAGATTAACAAAGG
ACTTAAGCATACTTTATTTTTTAAGTTAGTTACTCTGTTTCCCCATCCTTGTTCATCTAA
GAACAAAGAAATATTTTAAATTGGAAATATTAACTAGTGCTGCTGCACTTGCGTAACAGC
TTGGTTCTGATGTATTTACTCAATGAGATTGTATTGAGCTTAATGTCAGTAGGTATGGGT
TTGAATCCCAGTTTCTTCACTTAACGGATTCAAACAAATCATTGCACAAACCCTCTGGAG
AAGTCAGTTCTTAATGAGAAATCATTGACTTAACTACCACTTTAGTAATTAGTGGTTATC
TCAATTAAATGAGTTGTGGATATTCAAAGACAACATCAACGAAAAATTGTTATGCTCCAG
GGGGCTGATTGAAAACAGATCCAGGAATGGGTTTGGACTCACACTAAATCCTAACTCTAA
CTTAGAACAATTAGTTTTTACATCATGGCCCCGCTCGATATTTTCCTTTAGGAAGGGAAC
ATAAAAGATGTGAGCGCTATAGCAAAATGTGAAGAAATTAGATGGTGCCCAGCTATCAGG
TAAAATAGCATCTGAGGTCTTAAGGCTTATTTCCAAACAAGCAGCCATCAAAGTGAGATG
TCAACTAAGTCTACATGGAAGAAGCACACCAACATCAGCCACCGAAGGATTGTAAATCAT
ATAATCTGCAGTTGAAGATGGGGATAATATCGGAGTCTAAATGGTGAGAACCAGTTTGCA
GATGGCTATGGATGACAATGGCAGCCCAAGTGGTGGGATCTACATAGGAAATAAGTCTCC
AGTGATTTCCCACAATAAAGGGGTGGGAGACAAGTGCTTACTAAACAGAGGGCGTTGGAG
AAATGAGTATAGATCAGAAGGATAAACTTGACCTAAATAATTCAAACCTTGTCAGTTTAG
GCCTGATCTGGTTTTCAGCATTTTCTGTATTTTTTTGTTTTTTGTTTGTTCATATTGGGG
TTTATCTTAGATGTGTTATGTCATTGGGGGTGACCCTTTTGAATTTGTGTTAAATGTTTT
TCTGTTTTTCGGTATATGAAATCCAGGATTGATGAACCTATAGGGACAACAAGTAGAATA
AGGGTTTTCGGTGAGGTGGGTGTAAGTAAGGTGACCAGATGTTAACATTGGTAAAGCGGG
ACACCACTGATAAAACTCATATCCTGGCGAAATAGCCACATGGCAGCCGAAGACCATATA
CCCTAGCTTGTCATTCATTCTTTCCAAAAATTGGGACTTTTTTAAAACGCCGCGGGACTC
AGGAAAAATTGTTAAAAATCGGGACTGTCCCGCCAAAAGCGGGATGTCTGGTCACCTTAG
TGTACAGTAAAGAGAGCGATAGTAAAAGGGAGGCGATGAATACTTGGAAATTGATTGTGG
TAACAATTGTACATTACTGCTTGATGTGATTGAACTATAGAGTGATATATGTATTAACTC
CCATAAATAAATAAATAAGTTGTGGAAACACATTGTAAAGTAGAGCGAATTATATAAATG
TGAGGTGGTATTACTATCCCCTGGATTAGCCTAGATTTCTGAAGCAAAAAGCAATGTTAG
CATAACCAGTCCCGTGTTGGGAACATTTTGATACAGGCTTAACTAAGTAATTTCTCAGAT
TGTGTAGCTTTCTGGGAGTGGATGTGTACCCTGATAGAGATTCAAGCAAGGGAAATAAAG
GAGGAATGCTAAAGTAAGGTCATTAGTGGGAAATATTAAAGTAGTAGGTTTCTGATTAAT
TTGAGAGATGACTAAGATTGTTCCTTGTAAAATTAATTTGCAAAGAGCCTGCTAATAGTT
TCTGACTCATTTGAGAGAAGCTGTGTGAATGTAGATATATTTAAGTCTCTATAGGATTAC
TATGAGTCAGAATCCACTCAACAGCAATGAGTGAGTTCATGGTGTTCTAATTAGGTAAAC
GGGTTAGTTTGACAGCTTAATTTTAGCTATTCTTTTCTGTTGATTTTTACACAGGTGTTG
CAGGACTAACAGAAGCAGTAAAAGAGATTTCACTGGAAAGCAAGGTACTGGTTAATTATA
TTTTTAACTTCGATTACCTCATATTTTACTTCATGAGAGTCCTTTCTAAATTCCAGTTAT
TCTATCTGCACTCCCTTTCTACTGAACATACCAAAACTTCAGTTTCCCATTACTTCCCTT
ATTTTTCTTAATCTGTCAAAAGGTAAAGAAAGACATTTTTTATAGATACGAATACAAAGT
ACTCTTTCCCATTAAGAAGTCTTAAAATTTGAATTTTTGGCTAGTTAAGAAGAAATTTTC
TTGATTATCTAGTGATGCTGTGAGCTGGCTTTAAGAAACACACTTAATGTTTCTGTTTAG
GAAGATAGAAGTCCAAATTCAGGGCACCAGGTCTACCAAAGGCTTGCTTTCTGTCAGCTT
CGAGAGAAGGCCCTTGTTGATATATGGCTTGTCTCTTGAGACCCCTCCACTTGTGCTTCT
TAACTTATGTCAGAAGAGATTGACTCAAGAAATGTCCTGCACTGATGTAGCCTCATTAGC
ATAACAAAGCCCATCCCAAGTGGGATTGTGTCCATAAGATTTACAGCATATATTTTTGGA
GGTTATAATTTAATCCATAGCAAAATTATTTTTACTTAAAATATATTTAAATCAGGTTCA
TTACCATCAAGTAAATTGATGCCTTATCTCTCATCTCAAAACTCATGCAATCGAGTCGTT
AACATCTCTTAGTGACCCTAGAAGTATTCGAGAGTATAATGTTTTATAGAGGCAGACAGC
CTCATCTTTCTGCGTGGAACAGCTGATGGGTTTGAACCTTCAACTTTGCAGTTAGCAGCC
TCACCCACAGCTCCATTGAGGTTCCTTACAAGCATCTTTAGTAGGTGATAATGCATAAGT
GGATGCTTTGGAGGGTTTTTCTTGTTATTAGTGGACACTAATAAAAGAAAATGTTGACAT
TTAGAATTTGTAGTTTAAATATTCTGCTAAACAGTTTAATCATTCTATATTTTCTTAATT
TGTTTTTCATTTTAAATGTAAGCTTTAGCTTAATTTTGTCATGACATTCTGAATTAATGT
AAACGAAATTAGTTAACTTTTGTTATGTGGTTTATTTGGGGGGAATGTAGTATTATATAA
TTGGGTAACATTTTTTCTGCTTGGAGGATTTGGTTCATTCAGGCTGAGTATTATATAAAC
TATTCCATCCTAACGAGAAAACAATTTGATGTTTTCAGTTTGAAATCATTTGGAAAAGTA
ATACAAAATACCTTCACTCTTTTAAGATTATTTTAGTAACCAAATCTCATAAATGATAAA
TTACTTAAAAGGATAAGTGTTCCTATTGTCCTTATGAAACAATGCCTGCAACTGTGACTA
GGTTTAAGATATTCTTTATATATTTTTGTCATTTGAATCTTGGGATTGTTAACTGAAGCT
TAGTAGAGAGTATTAGAAACTAAAATAAGGGTTTTGTTTTTGTTTTTTTCTCTTCACAGT
AGAATTTTATTTGCTAGGGATTAAGATTCTGTTCATCTTTTTGATATTCTACTTTGGGGA
GTATCTGAGAGACTACAGAGAAATCACATGTGACTATGTTGCTTCCATAGCACTTGTTTG
CCTATTTCTTGTCAGGGCTGATTTCTTTGAGCCTCCTCATTTAATGTGCCTTTAAGATAG
GCTTCAAAAATGTGTATAAAAAATGCAATGAAAAGATAATGGAATTTACCATGACCTTTC
TGAAGCTCCCTTGTATTTATTTAGGTCCTAATAGTGAGAGCTTTAGGCTAGGGGAAGTGT
GTGTGTGTGTCTGTCTGTCTGTCTCTCTCAGATGTATGGTAATACTCCTAAGTAAGTGTA
GTAATGGTTAAGATAGTACTCTGTGTTCCATTGACAGTTTCATGCCCTGCTGCAAGATGA
TCAACTTAATCAGATTAATTTACAACTAGACTGCATCGTTACATTCTAGTTAATACACAG
TATCCATTCATTATTTGTTGTAAGTCAGTGCTTAGAATACTTAGCATCTAGATCCAGCAT
CCAAGAGTTAATCTTTGTTGTCGATACCTGCTGGGGTTTACTGTATCAAGGCTGAGCGTC
ACCACCATGATTCAAACTTCTCAGTGTCCTCTCTGTCAGGCATTGGCTGATTCCCACTCA
TGGGGATGTGGCTGACAGAGTGGAACTGCCCCACATTGTCTCCTAGGCTGTAATCCTTAA
CAGCAGCAGATCGCTGGGTCTTTCCTTCTGTACAGCAGCAGGTGAATTTGAACCTCTGAC
CTTTCTGTTAGCATCTGAGTGCAAGTTCTTAAGTTTGTGCCACCACAGCGCCTTGTAATG
CCTGACAACTTTTGCTTAATTCAGGTAGAATATTGCTGAGAAATTAGATCAGTGAATTTG
ATTTATAATTTATGATTTGCAAATATAACTTTTCCATCCTTTATAAGTAGGAAAGCATAC
ATAACTTTGAACTGAACTTCTAAAGTTAATGAATTGATTAATAAAAATAATTGTTTTTCT
TATTGGAAATTGTTCACTATTTTAAAATCATTAGCTTAGATGACTTAGTCCTCCTGTTCC
TTTTATGGTTTTCAGTCACAGCACTTAGCATATTGCTCTAAATCACAGGCTACCAAATTT
AGTTGGCATACTCCACCATTTTGCCACCCTCTTTGCACCCCTCCACGCCCCCCACCCCCA
GCATTAGAAACTTTATACTGTAGCCCATCATCCAGGGTAAAGTGTAAGTATCTGCTTTTG
CAGTCCCCCTGTTCCACTGCTTCCCCTATTCCCAGGGGGCAGTATCACCCACTTTGGGAA
ACTTGTAAATGATCGATTTATGAGCTTGTCATCCATTGTTAGAGTATTATGTTTCTTGAA
GGTAAGAACTATTTTATTCTTAGGTTCACAGTGGTTACCCTGCTAGTACATGGTGGTGGG
GTGTGGGTGTGTGTCTCAGTATTTGAGTTAATGAACATATTCCAATGACATTTAAATTAA
TTTCAAAGGACAGTATGAAACACCAAGATTGCCCAGCGTTATGTGAGGAAGAAGAAGAGG
AGGAAGGGGAAGCTGCAGATATGGAAGGTATTAATCTTCTAGGTTTTCTTTGACAGTATT
TCTGTTTGATGAGAATGAGCTCTGAATTCTACCTTAGCAGTGTAGAGGACTTTGTTCAGA
TTCAATCAGTGTGGAAGTTACCTTGGTTTTGGACTCTCCTGTTTTACTTGGAGCATAGTC
TTGACAACATGAATCCTATTAGGAAAAATGTTGGTCATAAATCTCTAATGCTGGATAAAG
CTGCAAGATAGAGACTATTAAGCCACCTTTTAAACTAATTATTTCAGAGCATAACAAGTA
GTTTTCTTCCTCTTTGATATCACTTTTCTAGTAAAACACTAAGAAAGTAATTCTGCGCGG
GAGTCTTTTCAAACGATGTAGAATCCCTTCTTGCCCTGAAAGGCTGAAATGCCAACCTAA
GGACTACCAGTGGAGAATCACTGCATTAGTGCGCCACTGCTACAGAAGATTGAGATCCAC
TACTCTTAAGAGCAGAGTCATACAGGTCTATAAACATATGACTATTAATACCTTTTTATT
AATAAGGTACACTTTAATACATGCAAAACTTCAGATATTTAAAAAGAGGTGAAGGTATCT
GCTCTGACTCACACCACTCTACTTTTTCATTTCGGTTCTATAATTTCTTGCAGTGGCCAA
ACTCACAGAGACGCTTCACAGAAGAGACTTGTTGTGGAAGCTAACAAGTTAAAATGCTCA
GGTGGAAATGCTTAGGATGCAGGTTGTGTTAGGGTACTTTAGAGAAACAATCCACAGAAA
CTCATGTATAAGAGAGTTTTATAGAAAGGTTAAGTGCACATCAAGAAAACATCCCAACCC
AGTCTGCCCAAACCCACAAGTCCAACATTAAGGAGAGCTGGGATTGCTGACTCATGAAAT
TGGAGCTATGAGCCTTTTGGTTGAGGTTTAATTAGAGTAGGGTGCTTCTGGGAACTTAAC
CCATATGTCCAACACCAATCCACAAAGTCCTCCATCTCACAAAACAGATGCAATGTTGCC
GACTGCAGAAGGAAAGACGAGTCAGTGAATGTGTAAACATCTCGGTGCTGGAAGGGGTCT
TCACACAGCTGCTCCAGCTTCATGAGTTAGCAATCCCAGCTCTCCGAACTAGTGCTGCCT
GTGAGCACTTGACTTCACAAGCCAGCATCCTGCCCGAAAGCACTCAGCCTCACTTGCCCT
GTGCGTCAGGGAGCCCACCACTTTGTCTTTTGCTTCTGCCACTGCCTCTCTGCCCCCCCG
CTGTGTCACAGCTAGCTTCTGCATCAAGGAGGCTCCATGTCCCGAGATGCATTGCTGACT
AGCTAACAGTGAGCTCCCCACTTTCTGCTTTTTAGGGGGCTCATTTTATACTCAGCCGTT
GGCAATCACAGTGACGCTGTTTAACAAGTGCGCACAGCTGAAGACTATCAGTGTGTTCTC
CTGCCTTCTCTTACCAGACCATCAGGAAAAGGTCTTGTGGTGCGATTACAAAGACTGACT
CGATGTCTCCTGGATGTTGCCCACTTATCAAAAAATGAACTCATCATCTTCTTATACACA
CTCTTTCCATGGGTGCTGCACAGCTGTCAAGGCCTGGGTGGGAGGTGTGGAGGACGCTGA
GCAAAGCACTGTTTTAGAGTACAAGCCACAGGGCTTCCCTCGATATCTGACAGCCTTTCA
GCATGTTTGCATATTTCCTTTGGATAGTGTTAGGGAAAGAATTGCTTTATGCGGACTTCT
GGCTCAAATCTATTTTAATGTGTACTTCATGTAACAGGTGCTTAATTTCCACTCTTTACT
TCACAGATTTTTATAGTTATTCAGTATTTATGTGTTAGATGCTGGCGATAAAGCAATAGA
TGTGATCTCATGGAGTTTGCTTTGTAATTGGGGAAGACAAACAAAAAGCAGTAGCTACGT
AAAATATATATTTTGTTAGATAGGTGTAACTATTATAGAAAAAAAAATATCGAGGGAATG
GTCAGGATTGAGTAGTACTGCTCTTTTTAAATTGCTTGGTCAGAAAAGACCTCCATTGAG
AATATGTCATTTGAGTAAAGTTCATAAAGAAATGAGTGAATGCGCTATGTGGGCCTCTGG
GAGAAGAGGCAAAGACCTTGAGGTGGCTTATATAAAGTGTAGAATAGAACCTACTCTTGT
CTAGAAGCAGAGGGAGAGCAGAGTCATAAGAGGTAGAGTCAGAGGTAAACAAGAACTAGA
TCATGCAGGAGCCTAGCTTTAACTAGAGTGACATGAGAAACTGTTAGAGGATTTTCTAGT
AGAAGAATGAGATGATTTAACATTTTAGCAGAATCCCTCTGACATCAGTATGAATAGACA
GAAGAGGGAAGAATGTGATAGTAATTAGAAGGCTAATGTGATTGTCTAGGGCCCATAGGT
TCCTAAATTTATTTGTCCTACTCCCGCTATTCAGAAAAGAAATTATTCAGTGTCCCCCCT
GGCAATTAAAAACGTTTGTATTGCAGCCCAATAATGCAGGATAAAGTGTGGGTATCTGCT
TTTGTGGCTCCTTGAATTGTATTACCTACTTGGGAAGCACTGGATTCTAGACAGTAAATA
GTAGTCACAAAGATGGTGACATTGGAAGTGATAAGAAATAGCTAAATTTTGGATGTGTTC
TGAGGGTAGAGCCAAAGGGATTTGCTGCAGGATGGGGTTTGTGATATGAGTCAGACTTGG
TGTCAAGTATGATGCCAAAGCTTTTAACTTGAGCTTCTAGAATGATGCCAATTCCTGAGA
AAAATCTAGGAATCAGAAGCTCAGTTTTGATATAACCTGTATGTGATGCCCTTTCAGGTG
GAGACATGAAGTAAACAATGGATATCTAGCTCATAAGTTAGGGATATATTTGGGAGTCAT
AGCCTTCAGATGATATCTGCTCTAATTCATTAAGGGAATAAGTTTAAGTAAGAGGATGCA
ACAGCTGAGCCTTTGATGACTTCTGCCTTGTCACAGAGGGGGATGTGGAAGAAATGGAGA
GAGTAAAGGAGCACAACCGTGAGTTGGGAGGAAAGCGCATATATTACAGGCCAAGGAAAG
GTAGAAACATCTGTTTACAGCAAGTGGAGGCCACAGATGACTTTAACAAGCACTTTTTAT
GCAATTGCATAAATAATCTTGTATATATTGTATAGTACTAGAGTCTACGGTGTTACTGTG
TCATTGATGTATTGAACCATAGACTAAACCTTAAGTATACAGACTCTGTCTATATTTTAT
AAGTATCTACTATTTTGGCAATACAGAATTAGTTCATTTTTTTATCTATTTGGTATCTTC
AGTAAAAAACAAAAGCAAAAGCAGTGTTTAAATAATAATCTGAAGCAATATAACTTGATT
TAGGGATTATCTTGGACTTGATTAATCTTTTGTTGTTTTTTATAACAGAATATGAAGAAA
GTGGATTGTTGGAAACAGATGAGGTTTGTCAATTGAATTTTCGTAAGTTAACTTATGAAT
TAACTCAGGGATTAGTGTTCTTACTAATAACATTTTGGTGTGTCAAAGATGTCGTTATTT
GTATGCTCACGTTGATTATAACATATATGATTTTACCTTAGAGTTTTATGAATATCTGAC
TATAAGAAATATATATATAAGTATATATAAACACATATCTGATGGGGAAAAACTAATTTT
CTAGAATGTCTTCTTCATGTAAATTTTAATGTACTGATTTTTTTCCTCACTATAATATGC
TAGGCTACCCTAGACACAAGGAAAATCGTAGAAGCTTGTAAAGCTAAAATTGATATTGGA
GGTGAAGACGCTATCTTGCAAACCAGAACGTATGACCTTTACATCACTTATGACAAATAT
TATCGGACACCAAGACTGTGGTTGTTTGGTTATGATGAGGTAAAAATAATTATGTTTTAA
TATAAACATTTTAGATCATTGGACTCAATTCCTCCATTATTATGTCCTTGCACCTTGTGT
TCTTTTAAGTTTCATAAATCATTTGTCTTATTTTGATTGGATGATTAACATAAGATTTAA
TTCATATCTTGAAGAAGCTGAATTGCTGAGTGAAATACCAGTAAAATTTAAACAGAAATA
GTCCATTGCATATTTATTCCTTGGCTTCTGATTTAATCCCTCAAAAATGTAAGGAAATTG
AACCTGGCTTATGATACATTTTGTTTGAGGGGTTACATTTGTGGTACATAGAGTCACTTA
CCACTGATTGTATTGTATGATTTTTTTTTCTCCTTGAGACAATACTTTTTTCACCCATCT
AACTGAAAAAAGAATAGTTGAAAGAAATACCTTATGTGGGAAACAAAGGCCTAAACAATG
ATTTATAAAGTTATAAAATATTTTGACAGCTGTGAACCTGGTTTTTTTTGTGGCATCCTG
ATTGCAGTAAGTGGTGGTTATGTCATATAAGTTGCTTCTACATGCCTCTTGATACAAATG
AGCTGTGGATTTCTCCTCAATAAAGCTGGTGTTTCTGAAGAGAATGGAATTCTAAATTGC
AAGTGAAAATGCATATGGGTGTGGAGGATAGAGAGAGTATAAACATTGAGATTCTAGGCT
AAAAGTTTCTTACCAGTAACTCTACGGTGTGTGTGCATGTGTGTGTGTGTGTGTGTGTGT
GTGCGCGCACGCGCTTTCAGCAACGGCAACCCTTAACAGTTGAGCATATGTATGAAGACA
TCAGTCAAGATCATGTGAAGAAAACAGTAACCATTGAAGATCACCCTCACCTTCCACCAC
CGCCCATGTGTTCAGTTCACCCGTGCAGGTTTGTACATATTTTGTGTATATTCATATGTG
TATCTTGTCTGCTTCTTGGGATTACTCTTGGGAAGCTATAAATAGAATGCTCTAACATTA
AAGATTTATTTAATAAGCAAATAAAATTCCCTTTTATTTTCCTTAGAAATGTTCTTATGC
TCAAATAAGTATAAGAAAAAGGGGGAGGAAAATTCACTTAGTTAAGTTTAATACGTTAAG
AATGCATGTGTGTTTATTTAGAGAGTGATGTGAATTGTACCCATTTTCCAAGAATGGATT
GGGAAAGCCTGTTTTGGATTGAAACACTAATTTGTGGTAGTGTAAATGTAGAGAATGAAG
TTGACGATGTGCTTTCCTGGATCGTTATTTTTGTTGGGCAATGTGATATGAGGGTTTCCA
TTTCTTTTATTCTTCAGTTAAGAGATCTGAAGCTTACAAATAAAATCCATTTTATTATTT
AATATTTCATCTAAATAATAATCTTCCCAGACTAATTGCATCATAGACTCTTTAGTTCTT
TATTGTGGGAATAATAGGAAAAAGGAGAGCAGAGTGGAGAAACAGACCCTTTTATGGCCC
ACTCCTGGTCTGTGTGTGAGTCCTTAATACGACACCATGAGGCAGAGTCTGCCCAGGTTC
AAAGTTTAGGTTAATTGTGAAGTTCTGTACCTGCATTAGCTTTTTCTTTGTTTGGAATTC
CATATTGCAGTGGGATTTTCTTTTTGCTAATATTGAGGCTGAGGCTATGTGCATATGTTA
TTAAGAACTTTCTTGTTTTAAATGGTGTTATATTCTCATTGTTTTGGTGTTACCTTCTGA
AAAAAATTATCAGTTTTATTGGCATATAATTCATTTTTACTTATTTTTAATAGTTAGCTT
TCAGCTACTGATTATATACTGGTAGCATTTTTTTAAATGAAACTTTTAGTGTTTCGTTAA
CCAGTTAGATGAAACATTTATTTTCCTTCCTGCCTCCTTTTCCTATTTCAAGGAAAAACA
GAAACTTTACTATTTGTTTCACTTTATATGGCATCTTTATTTCGCAGCTCTACCTTACAA
AAAGCCGTGTTCATTACTCTAGCTTTTCTATGTCAAGAACCCTTAGGAACTGTTGTTAAC
AGTGACAAGTAATGCAGCATTCATTAATTTTAGTTTTGAATTATCTATTATGATCTGGAA
GTTATTCATATTCAGAGCTTTTCTGTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAACATTTTAGCAAACATGACTTATCTTAGGGACAGAATGTTAGTCTGACGA
GAGGTCTATAAAGTAAGACTTAATAGACATTTTGGGCCTTACCATGGGCCATGTTATATG
CTTCCAGATCTCCAAGGTGAATACGTCTACTTTAATCTTCTCAGTGGATTGCCTTTGTCT
CGAAGTTTTTATAGTAATAAATCTTTAAGAGGCATTATAACCTTCTCTATGCATGCAGGA
TTCTTTTCTAAGTCTGTGTGCCCAGTGACATGGTGTATTGCTCTTTTCTCTAGCACAGGA
GAGGTACCAGCTGTCCTTGAAAAGATTCGTGTATCAGACAAAAGCTTATGATAAATACTT
ACATCAAACAAAGACTTTATTTCTAAATAGAAGTATTTAAAATATACAAATCTTTTCATA
TCAGTTATGGCAAAGGGGAAAAAATAGACACTCTTCCCTCATACAGTTAGCTTTCCTTTG
AGCCTCTTGATTTGGGCTTTGTTATTAGGTGCATTCGAGTTGGTTCCAGCTTATAGGAAC
CTTGTGTACAGGAGCACGGAACCAACCCTGCCCGGTCCTGCGCCAGCCTCACAGTTGTTC
ATTGGTGCAGCCACTGTGTTCGTCCATCCGTCCTGTTGCGGGCTGCCCCTGCTTTACCAA
GCACGATATCTTTCTCCCGGGACTGAGTTTGTCATTTGGGGCAACTCAGCTAAATAGTTA
AGCAGTCAGAATCCTAGGGTTTCGATCTTTCTTCTTCTTTTTTTTTTTTTTAACCAGTTT
TACTGTGTATCTTTTTTGAACCTGCCTGAACTAAATTGAGGAGCCCTGGTGTTGTAGTTT
TACATGTTGGGATGTTACCATATTCAGCTGCTCCCCAACATGAAGAAGAAACTTTCTACT
CCTATAAAATTACAGTCCCCCACAGAGGTAGTTCTTCCTGTCTTATGAGTGGGAATCAGC
TCAGATGGCAGTGCAGTGTGTTGGCAATGTTCCCTGGCGTGGCTTTCTTTTCTCTGGTTT
TCCACTGCCTAACTCCCCGTTCTGATAAGAAAGCTGACTGTGTGTCCATTGTGTTCACTG
TGAATCCTGCAGCTTTAAAAAAGCACCTGCTCCTTCCCCCAGTAACACTGCCCGCATGGG
GCAGGGAGAGTATATTTCACAATGTAACTGTTATATTTTAAAAATGAATTCACTGTTAAT
AGGGTAAATTACTACAGAAACACAAACTTGCTTTTCAAATGATTGCGATTTAATTGAATA
CAGTAATTATTCTTTTGCTTTTAGACATGCAGAAGTGATGAAGAAAATTATTGAAACAGT
TGCAGAAGGAGGGGGAGAACTTGGTGTTCATATGTATCCTTACCTGGGTGTATGATTGGT
GGAAATTTAGCGCTAGGATATGATTTTCCCCCTTTTGGGGAAGCTTAGTGGTATAGTCTG
GGAACTGTACAGTTTCGGAAACCCACACGGGGTCACTATGAGTCCACATGGACTCTTTGG
CAGTGGGTTTGGTTTGGGTTGGAGTGTCATCTTAAAGACAATATCTATGACCCCTTTTGG
TCCCTCAGATCTGGAAGTCTGCCCTAGTGGAAGTCTCTACTTTATTTAGAAAATGTTATA
TTGTGATAGCTGTTACACATAGACTAAAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACCTGAGAATGTAGAAAAAGATACAAT
ATTTCATTCAAGACAATCTGACATACAGATTCTTTGGCAAGAAGGACATGAACTAACTAG
AAACAGTCTTTAAGGAGGATTTCCACTGGTAGCATAGTGAATTGCATAGTTTGCTACTTA
TTCCAAGTGTAGTTTGAAATCCCCAGCTGTTCCGCAGGAGAAGGATGAGGCTTTCTACTC
CCCTAAAGAGTTAGTCTTGGACACTCACCAGGGTAGTTCTCCTCGGTCCTGTAAGGTCAC
GTGAGTCTGCATCAACTTGATGATAGTGAGCTTTTTGACTTTTTTGTGTCAGTGCTTTTA
TATTCTTTAGTCTATCCATTTTCTCTAAATTATACTTAAGCAGTAAAGGGATCTTTTCCC
CCTTAAATATCTATCTCCTTATGTGTATATCCAAGTATTGGGCTGAGAGGTGCGGTTACA
TACCCCACTGCTCTCCAAAAGGCCGGCAGGTGCAGTCAGCAGTCACTCCAGAGGAAAAGG
AGTTGGGCTCTGCTCCCCGAAAGACCGATCGTTCTGAAAACTGAGGCAGTTTTACTCTTC
CTTACAGTGTCACTGTGGGTTAGAATTGACCTGACAACACTGGGTTTGGTTTGTATAGTA
ACTCTTACTTAGTAGCAAGTTTCAAGTGCAAATATTAAATGGCAGTTGGTAGTCAGTCTT
AAAGCTAGAGACCTTCATTTTGAATAGATACAAATCTGTGTGAGTGAATTTTTGTAATAT
ACTTCCTTTAATATTTTTATCTTAAAATCTATTAGGATGGAACGATTTTTCTGAGAAGTT
ATTGCTTAATAAAAAATTGAAAATTGCAGTGTTGCCTTAAAATATTGAACTTTTAAAAAA
ATCTTATTTTCCTTAGCTACCTTCAGGTATCTTCTAATATTCTTGAAATTTGTACAAGCT
GTCATTCCAACAATAGAATATGACTACACAAGACACTTCACAATGTAATGAAGAGAGCAT
AGAATCTATCCTAATTATTGGTTCTGATTTTTAAAGAATTAATCCATAGATGTGACTATT
GACCATATTCATCAGTATACAGAATTTCTCTAATAAAGGGACTTAACATGTTTATGCATT
AAATAAAAAAAAGTGTTCCACTACCAGCCTTATTTGTTTAATAAAAATGAGTGCAAATCC
GTTGTCTTTCTTGTTTCTTAATCAAAAGGGTTGTCCTAAATAACAGCTCTTCTAGTGAAA
TGCATCTTGTAGAAAGCTAAGGGTTTGGGTTCAAATTTAGGAGGAAGATACTAAATGTGT
AATGGCATGTCATAATTTCTTGGTGCTACTGTAACAGAAACACTGTTCCAAGTGGGTGCC
TTTCAAGACCAGACACTAACTTCTCATGACTCTGGAGACAAAGTTCAAATGAAGATCTCG
GCCATGTGGGTGGGTTCCTTCCCAAGTCCCATAGCTCCTGGTGTTTCTTATTTATCCTTA
CCTGCCACTTTTCCCTGTGCTTATGAATCTTTGTGTCTATTCTGGCCTTTTAAAAACATA
CGTAATTAGATTTTTAAGCACCTATCCCATACTAGTATGGCCATAATGGATTGATTAGAT
TATGGAAGATGATTGTATTATACTACATTGGATGTGTATTGCATCCACAAATGTAGGGTT
TAGGATTCCAACACATTTTAGGGAAATAAAATTCATAGTATCAGAACTAGGTATAGAGTG
CATGCTAGACCTTTCCCTTTGCTTCTTTTCTCTCCGTCTCTCACACCCTCTCCAGGTCTC
CAATTTGCGCTTGCTTTGTGCTGAGTTTTGGTGGTTTTACTAAATTGATACTAACACGGT
CCCTTTTTTTCTATTAAAGATGCGGGAATATTTCTCATATTGTGATTTCCTGATAGAATA
TTTCATAGCATGGTAGAATATTATAACATGAAGGTATCTTGTATCACAAAGAACAAAACA
CTGCCCAGTTCTGTGCCATCTCAAGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1072, 4253..4294, 12048..12097, 15749..15819, 17466..17542, 17544..17570, 17572..17575, 21954..22003, 24968..25046, 28428..28462, 28743..28898, 29660..29787, 32364..32432, 34286..34367
1001..1072, 4253..4294, 12048..12097, 15749..15819, 17466..17542, 17544..17570, 17572..17575, 21954..22003, 24968..25046, 28428..28462, 28743..28898, 29660..29787, 32364..32432, 34286..34364
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved