Echinops_telfairi Locus ENSETEG00000018160
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000018160
Echinops_telfairi
ENSETEG00000018160
scaffold_290038
SNORA62, SNORA62
1611..1762, 3716..3869
6513
CGGCGCTCCCCAAAACCGCCGGGAGCCTCTTGCCCCCACACAAGGGGTGCGAGGACTGG
GTGAGGGCCGACCCGGCGCGTCGCAGGTGCGGCTCCGGCACGCTGCTTCCCAGAGTCCCG
TGGGAGCGGCCCGGTCGCGCTCGCCGCGTGGTTCCGGGCTGGGGTTCGGTGCGCGAGCCG
CGCGCAGAAAGCGGGAGCCCCCCTCTCCCCCCGACTCGTGGATTATTCGTTTGGAGGCCC
AAACCAACTATTTTGCTGATCTGTTCTCCTCCCGCGTGTTCATAACTTCTGGAAATGCTA
GGTTCCTGGCGGTTTTGAGGCAATCTACGAAAGGGATATCAAAGAATCAACGTCGACTTC
CAAATGTGGCATGCCCCCAACCCCCGCGCGCTTCTTGTCACCTTTGTGCCCCGCCTCCAT
AGTTTAGGAAATCTGGTGGGGGTAACCTTTGCTTCTCCAGAAGCATTTCCCTTTTTGTCC
TGTGCGGCTTTGGGAAGACTTTGTTTAAAGTTCGCGAAGTCTACCGAGTCCCCTTGGGAT
TTAGAACGCTTCTTTTGGGCGGCGAGCATTGTAGCAAAGTGACGTGTTGGTGGTTATTTT
CCCTCTCCTAACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTGACCAAGTTCTCATTAGTA
GCTCCCCTTAGAAAGGCTGGAGTGAAAGGACTGCGTGTGAACTATTGCTTTTTTTTTTTC
TTTCCAGCTTCCCGTCGTAACTTAAAAGGGAAACTTTAACAATGTCCCGGAAGCCCTTGA
CGTCCTGCAGATGAAAGAAGGAGGATGTCCTCAAATTCCTTGCTGCAGGAACCCATTTAG
GTGGCACCAACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGTGATGGTT
AGTTATTGCTTTAAAAGTGTTGACCCTGCTGTTCTGAGCTCGATCAGCAGGGTATTTAAC
TTATCAGCTCTCTGAAATATGACTTTGGAATTTAAGTTGGGCATTGTGGGGAGAGCTGTA
TAAGTAGGGAAGATGGTGAAGAAGCTCATTCGGTTCCTAATGTTCCTTTAAAAAATGAAA
ACAAACCTTCCTTAGCGTCTTCTGCACTACAGGTACTGATCCAGGTTTGTAGAACTTGTT
AACAGGAAAGAGGTAGTAAAGATTTGGAAGGGCTAAAAAAGCCGGGGGCTACAAGCTGTA
TTGAGAATGTGGAAGGCTGGCAAGGCTTAGATGAAGATTTTACTTTGTGGGGAGTGGCCT
TCTGTTAAAGGTATTCAGGATGAATCTGGATGGGGAGTGGAGGAGAATGGGAGACTAGTG
GCCAGGAAGAATTCTGGTCTGAGGGTGGTGGTGAACCCCTTGGGATAGTCTACTGCACAC
TATTAAAGCTCAGGGTGGAGGCCAGTCTTGGCCAGTGAACTTCTGAGTGTCGGAAGTGTG
CTACATTAACAGGCAGGATTTTCGCTAGCACCAGGAGAGCTTGCCTCGATGACTGGAGTT
TGATAGTACTCTCTGCCACATGCGCTGCCCTGTTGGGAAGTAAGTGCATTCGCGTAGCAA
GGTCAGCCTCAATAGCTCTTTGTCCAACGCTAGGCATCTACATCATAAACCTGAAGAGGA
CCTGGGAGAAGCTTCTGCTGGCTGCTCGCGCCATTGTGGCCATTGAGAACCCTGCTGACG
TCAGCGTGATATCTTCCAGGACACGGCCAGGTCAGAAACCGCATCAGATTTTATATAAAA
GTCATTTAATGAATGTTTTATTTAAAGAAGTGACTAGTAATTTGCCCCGTTTCTGTTACC
TTATTGTAGATCCTGGGGAAATTCATAGGTTTATTTCCATTTCTTAGGATTAAAAATCCC
ATTCTGGTTGTAGAGAATAATTTTCTTTTTACCCTCCCATTCCCCAAAGCCAGTAAAGAT
CGTTTATTTTAGTGTGAAACTTTTTTGTGACTTTGTACAGTAAAGGTCTCCTGCAGTATT
TGTCCTCCTGCATTGATTCCATGTTGCAGAAATGCTGCTCTCAACATTGTTCTGTTACGT
ATGTGCCATTCTTCTGTTGGACTTCCTGGTTTCCAACATTTTTCTCGGTATTGCTGGATG
GATGTGGCTGTACACATCTCCGTTGCCACGGCTTGACTGTTTTGCAGATTTTGCAAATAT
GTAGTGTGTCTGGTCCTATTTCACATTAAGTGTTGAGCACGGTGCTGTTTGCCAGAAGCT
AACCTGTGGCATGGAATCTTTATTGTTGGGAGGGTGTACATGGTAGAGCGGAACTGTTTG
AATTCCTACTGTATGCTCGTATAAAAGTTTTAATGGGCATCTAAATTGGGTAAGGTGTTG
GCAAATGTTAGGCATATAGAAAAAAGAGCCTGCCTTTCTGAAGAGATAAGAGAAATTGAT
AAGACCTGGAGGGAAGAGACACTGAAGAAAGCAAGATATCTTCTTGGATTGTGGGGCTAT
GAGTAAATTTGACCCGCGCCTTTAAGTGCTTAACCAGGAGTCCCGGTGTCATACTGGTTA
CATACATGATAGGCAGCTAGCTACAAGTTCAGCAATTTGAAACCAGCAGCCGCTCTGTAT
AAGATGAGGCTTTCTACTCCTTAAAGAGTTAGTTTCAGGAACCTACAGGGTCTCTGCGTT
GGCATCTCCTCGAGTGCAGTGAGTTTGAGGTCCATGTAGGAGCGGCGGCAGGGGGTGGGG
GGGGTGGTTAAAGTGTCCCCAGAGGGAAGTGGACTAAGGGATGGCACACTGACCAGACTG
CAGTGGACGAGTGCATAAACAAACTGAGTATAAACTGAATTATAAGAATGATTTGCTTTG
TAACTCTGACCTAAAGCACAGTTGAAATGTTTTAAGAAGATTGTGGGAATTTATTAAAAG
ATGATTCCCTGTGAGTTTTTGAAAGCCCCTTCGTGGACTCTTTAATGCTGCATGTGTGTA
CATTTCGTTTTCAACATTTAGCCGAGTCACCCGTACTGGGTACTGTGGACATCTAGCAGT
CTGGCTCTAGAGCCTCCTGAGGACATCACCTCGGGGAAGTGAGGATGTAGGGACATCAGG
AGAGAAGTCCTGGAGTTGGGGATTAAGTGCTGAATTTTTAATGAGCAGAGCCAAGGGCAT
TCTCCCAGTGGGAGGGTGTTTTTTTGAAGCCAAGTGGAAGGCTGCTGACTGAATTTATTT
CATTCCTCTCCAGCGCGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCTACTCCAATTGC
TGGGCGCTTCACACCAGGAACCTTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCACG
GCTTTTAGTGGTGACTGACCCCAGGGCTGACCACCAGCCCCTCACAGAAGCCTCTTACGT
TAACTTGCCCACCATTGCTCTGTGTAACACAGATTCTCCTCTGCGCTACGTGGACATTGC
CATCCCGTGTAACAACAAGGTAACTGAATGAGAGCCCCAGAAATAGTTGCCACTCCTGTG
CACATTGTTAGAGCTTGGAGTTGAGGCCCCTGGCTGGCCGATGAACTCACAAGTGTAGGT
AGTGTGCTACATGATAGGCAAGGTTTTCGCTAACACCACAAGGGTCTCTGGCCCAATGAG
TGGAGTTTGATAGTAATCCTTGCTACAAGTATTTCGATGTATAGGAGTTTGAAGAGATTC
AAGGGTTTTGGAAAATAGCCACTATCCCTGCTTCCTTTCTTTTCTCTTTAGCCCTTGACC
TCTTGTCAGAATGTCCTGATCAGTGTCCTAGAGCTTGTGTGTGGCTCACACTGCTGTTTT
TGCCACTGCTCTCAGAACCATGGTTGCATGGACAGCACCTTCTGAGGACAAGACAGATGT
TAACACTGGTGTCGGGTTACCAACCCTCACCCCCAGGCATGTGCTGGAACTTCCTAAGTA
TTTTCTCCGGAACTTAAGGTCGCACATTGCTTGTAAGCCAGTGTTCTCATTTGGTGGCAT
ACACACAAGAAACCACAAGTTTTCAGGACATTGATCAGATTGTGGAGCAATTCTAAGTGT
GGGTGACCTTGGTGTGGTGGAATACTAAGTAAATTAGGTGCCATCGTAGGTGACCACCCA
GTTTGGTGTTTGTGTCTTGGAGTGGCTCTTGATTTTAATGGCCTGTTTTCATTGCACTCT
ACTGGGTGGCGGGGTGGGGATAATGTGCTGGTTTTGTTTCTTGGCCAGGAATCTCATGGT
CCTGAAAGTGTTGATGAGAAGACGTAATAAGGATGGAAGACATGCACACAGGCCGGTGGA
GAACTTAAAACTCTCCATTCTAATGTGCAATCAGGGTTGTTACCACTGATATACTGTAAG
GACTCTCAAAAGACTTGCGTATTATTTTGCTACAAGGGACCTAGTCTGTGGGGGCAGGTT
GGTGAGGTTGGCCGGGTGTCCTTGGAAGTAACAGCAGCGCTCTTTTAGGGAGCTCACTCA
GTGGGCCTGATGTGGTGGATGCTGGCCCGGGAAGTTCTGCGCATGCGAGGCACCATCTCC
CGGGAACACCCGTGGGAGGTCATGCCTGATCTCTACTTCTACAGAGACCCAGAGGAGGTG
AGTGCCTGCATGCAGGCTCTGGGCACGCGAGCTTTGGTGTCTTGGTGCCTGGGTTCCTTG
CAAGCAGGATCTGTCAGTACCTGAAAGTTTTGTTTTCTAAAACTAGATTGAAAAGGAAGA
GCAGGCCGCTGCTGAAAAGGCTGTGACCAAGGAAGAGTTTCAGGGCGAATGGACTGCTCC
TGCTCCCGAGTTCACTGCCGCTCAGCCTGAGGTGGCCGACTGGTCCGAGGGCGTGCAGGT
GCCCTCCGTGCCGATCCAGCAGTTCCCCACTGGAAGTATCATGTGCGTCCGTCGGGCTGT
AGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTGTTGTCATGC
TCAGCCAGAGTGCCACAATGTTAAACACAAGTCATCTCTAGTGCTCAGAAAATGAATTCC
AAGCTGGAACTGCTGTGAGTGGATTGGAAGAAGTAAAGTAGAAGTACTTCTCAGACAATC
GTCGCTGCCCCATGAACTTTTGAAGCCCCCCATCCGAGTGACAGCTGATGGCTTTTACTC
GATTTCTCTTTTTTAACAGAAGACTGGAGCGCTCAGCCCGCAACAGAAGACTGGTCCGCA
GCCCCCACCGCTCAGGCCACCGAGTGGGTAGGAACAACCACTGAGTGGTCCTAAACTGTT
CCTCCAGGGAAATTAGGTTGATGGGAAATAAAGACAAGTTTCTACAAAGGTTTCTGTTCA
TTTGTGTGATTGCTTTTCACAGGGGGTTTTCCTGCTTTTAACTGTAAAGAACCTTGTGTG
TGTGCTGAAATTAGAGATGGGGGTGCTAACCCCAACATCACTTCCCCAGTTGAGGATAAC
ATGCCTGCCACAATGCAGGGCTGAATGGCTCCCTTGTCCATTATGTTCACACTCTAAAGT
GACCTCAATTATCTACTAGTAAAGAAGTATTTTGATTCCTGAGTCTAGATGTGCAGTTCC
ATGCATCTTTTGAAAATAGGGGAAGCTTTCCACCATCTTGTGACTTGTGTTCCTGTTGGG
GGACAGCGGGAGTTTAGCTTTGTCTGAGAAGAGTGCCCATAGCGCTGATTGAGTCGGGAG
AGCACACAATCTGCTCGTCATGGACTAGGGCCCCTGAAGTAGGATGGCTCTTGCATGGCG
AGCCTGCAGGGTCATCTGGGGTGGGTAAATCCATCTGATTTTATTTTGGCAATCCCACAA
TGGCCCAGCAAATGGCATCTGGTTTCAAGGGTTCTGTTTTTCTGCAAAGTGGAAGCCAGG
AGATGGCAGATTGGGACTGTCTTGCTAGCTCACTACTACCCTGGGCTGTCACCATCTGCC
CCACGCCAGGCAATTCAGCTGCCTCATGGCAGCACCAAGCCGGCACAAGGAGCCATCCTT
CTGTATCTGGCTGTTCAACCCTAGTTTACACTTGGAAGGCAGCCCATGAGACTGAATCTT
AAGTGGTAAATCTCCACGCCTTTATGTATTACAAAGCCAGCAACATGTGGCCCAGTGTCC
AGTTGATTCCCAATCATGGTGATCCACAGCATGTGTTTCCCAGGGGCCGCAGTCTGGCAG
GCCAGTGCCAGCTACCCCACTGCCCTGGTTTGGTCTTGGCCTCCCTTTTCCCAGCCCCTC
AACCCCCTCACAGGCAGGCTAGAACAGCCTGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1006, 1009..1037, 1039..1136, 1833..1939, 1944..1949, 3433..3678, 4668..4796, 4906..5071, 5419..5513
1001..1006, 1009..1037, 1039..1136, 1833..1939, 1944..1949, 3433..3678, 4668..4796, 4906..5071, 5419..5510
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved