Echinops_telfairi Locus Poly:11:SNORA42
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Poly:11:SNORA42
Echinops_telfairi
Poly:11:SNORA42
GeneScaffold_1628
SNORA42, SNORA42
1001..1138, 1404..1530
2530
CACCCTTAGTTGAAAACCACCGGTTTCAATGGAGGGATTGGCCTCTGCTAGAAACACAG
ACATCCACATAAAGGAACGCTGGCAGAGGCCATGAGGAGAGTACGTGATAATTAATCATC
GCACTTGTCTTCTGCTCAGATTCTCTTAGGGTCCACATTGTCAGTTGAGGTTAGAGAAGA
CCTGAGAAGGTGCTATTACATCAAAAAATGAGCTGATACCAAGGGCTCAAGTAAGAAGAA
AACGTTTTAAAAAAATATAAAAATAAAAAAATAAAAAAAAGAAGAAAACGTTTTGAAAAT
GATGATGGCAACAAATGTACAAATGTGCTTGACACAATGAATGAATGGATGCATTGTGGT
AAGAGCTGTACGAGCCCCCCAATAAAATGATTTAAAAAGAAGAAAGAATGGGCCTTAGCC
TGCTGCATCATGAATTGGGGTTGTAGAGCAAAACCACAATGCAAAATGATTCTTTTATAA
ACTCGCTAAAACTGAAAACCCTATAATCACTATTAAATATTTGCCTTCCAGCCTTGTTTT
TAAAAATGACCCACAAACTAGAAAAGTCTCACTAAATCTGAATTGCAGATATTCTCTCAT
TATCCCCTTTTAAATATTGCTTTGCCTTTTACCATGGAAGGAAATTAAATTGGTCAGGCA
TGACTTATTTTTCCACTATGTCATTATAAGCTTTTCCCGGCATCCTGTGCTCTTTGTGAT
GATTCGATACTGTGATTCTGAGAAAAGACTACAGCCTACAAGCCTTCTGCATTCACCTCT
GAGAGAAAAACGAAAGGGCAGGGAGGGCAGGGAGACTGCTTACGGAGAATCTATGATGGT
CTCAGGTAACTACTCTCGGCCAGGTCTCGAGGACACAATCATAAACGAGAGCTTCCTCCT
CCTGAGTCTAAAGAAGACCCATTACTTCCTACATGTTCTGAACAGCTTCTCTGAGCCAGA
GAGCTGTTAGACTCCCTGGCTGTGAGTCTGTCCAATAGTCTGCTAATTACAATAAAACCC
AAACTCGCCCAACCCCATGGGCCTCTGATCGTGTCTCATGCCAGAGCAAACTGTAGCCCC
GAACCATTGCCTTGCCTCCTGGCCCACAGGCTTCCGGCACTGAAGCGGGTTGCACAGCGC
GGGGTAGGGATCTGGCCTGGGCAGAGACCTGTTAGACCACCCTTGTGAACACTAAGACTC
GTTTTCAATTAATCTTGCTTAGTCAGCTGAGAACAGCATGGGTAGTACCATCAAAGGGCG
GAGGGTCTCCGGACACAGTGCTTCCTCCCTTGGCGTGAGCTCCACGAGGTGTCTGATGAG
CTTTTCTGTCCCCCATGTCAAAAAACCCCCAAAAAACCCAAACTCACTGCCATCGAGTCA
ATGTCAACTCATAGCGACCCTACAGGACAGGCCAGAACTGTGAGATTCTGAGACTGTAAC
TGCAGTGTCCCATGCCAAAGCAAACTGTCACCCCGAACCATTGCCTGGCTTTACCTGGTA
GGCTTAAGGCACTGAAGTGGGTTGCACAGAAAAAAAAAAAAGAGAGAGAGAGAGACTGTA
ACTGTTTACAGAAGTAGAAAGCCCCACCTTACTGCAGCATTCAAAAAACCCAACAGAAAC
TCCAAACCACTGTACGGTGCTAGTCTGTTTTCTCTTTTGTCCCTGGACAAAATCTCAAGA
GAAGATCATATAATGCTCATTCAAGAGCCAGGTACTTCAAGAGTATCTCATCTGAGAAGG
TCATTTTACAAAGGAAAAATGGATAAACCTTTCAATGATAGCCATGTCTTACAGGAAGCT
GATCTCTGACCTCCCATTTCTGGGGAGGCATTATCTGGGACTCTATCAGCTTCAGGATAG
GTGTGAGGGGTCTTCTCACTATAGGCAGGAAGGCTAATTAGCAATCTGTACAAGGACAAA
AGACGATATATTGCCTCAAACTCACAAAGAAGCTGAACATGCACGGGTCGCCAAACTTTG
GAATATATAAATGAAACAGAACAAGAATGTCCCATGGGCCAACAGACCAGTTTATCCTGG
AAAACTAGCTTACTGTAAATTCTTGACTTAACGTCTTTTCCTTTAACTCTTGGCACAGAT
TATCAATAGGTAAATGAGCTTTTATTATACCTGTCGATAAACAGTTGACATAGAAGCATA
GTTCTGCCCAACTCCTTGTTTCCCCTGACTAGGAATGATCTTACTCCACCTGAATTCCTA
CAGGAATCATTAGTGACCCACTTACACCACCACACAGTTGGCATGCTGTGATTAAGTCCA
GGTCTTAACTTTGCTCTTCAATTGCCAGCTTCCTATATACCTATGTAACACAAACTCCCT
GAACTCAAGACTAAGTCTTCTTGTTCTCTCCTTGGCTCCCTTTTGTTTAATCCCCCGAGT
CCAGGAAATCTGTATTCCGTAAACGTTTGCTAAAGTATAAATGATCAAAGTTGCATACTA
CTATAATTCTAGGATTCAAATATAATATTACCAAAAAAACTCAAGCCCATAGCTGTCAAG
TTATTTCTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved