Echinops_telfairi Locus Mono:96:SNORA24
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:96:SNORA24
Echinops_telfairi
Mono:96:SNORA24
scaffold_252740
SNORA24
1001..1109
2109
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTACATAAGTGGCGTAAAGCACATTTGT
ACATTCATTCCCTCGTCATTCTCAAACTATTTGCTCTCCACCCAGGCCCCCGGCTTCAGG
TCCTCATTTTTGTCCCCTCCCTCCCCACTTCCCCTTCCCTCATGAGCCCTTCATAATTTA
TAAATTGTTTATTTTGTCATACCTAAAGACACACAATGGCTTTCTTAATAAAGTGATCTT
AAACAATTTAAGAATATTATAAGAATGCTTCAGAAAGTCTGTAGAAATTTCGATTATTAC
TTAATTCCATTTTTCACAAACATTATAAAGCTCCCTGTTTTTAAGCATATTTAAATCATG
CTTTAAGCAAAAATCCAAAATTCTGAATCTAGGGGAAAAACTTGAAATAAACAAAGAATA
TAACTTCTTAGCCCATTTTAAAAATTGTTTTTTTTTGTTAAGTTGTAGAAATTCTTCCTG
TATTCTGGATATTAAATTCTTCTTAACTATATGGTTAGTAAAAACCCACACCACTGCCAA
GAGTCAATGCTAACTCATAGCGACCCCCTGTGGGTTTCTGAGACTAACTGTAACGGAATT
AGAAAGTCCAGTCTTTCTTCTGCAAAGCTGCTGGTGGTTTGAAACAGCCAACCATGCTGA
CTGCAGCCTAATAACTACTACTCTACATGGTTACAAAACTGTAATATACTTAATAGCAGT
TCATTAACATTCAATACATGAGATGAAACAACTTTGAAAACGTCCATGTATCTTTGGGAC
CTGTCGGCTGTGGCAGAGTATATTCTTGTTTATTGGCAAAGCTGTCACCATTTAATTGGT
ATCAGATTCTGACTGGCACAAGTAACATTCTTAGCTGTTAACCTGATGTGTTTAGAGTGG
ATATTGGACAAACTTTTAACTGTAGTTGAAATATTTTTAGGGTGCAGAACTAATCCATGG
ACTGAGGAGAGAAAATAAGTTCCCAAGAAATCCCAAGTGAAGAGTCTTCAGCAACTTGGA
TGAAATTTTATTTTAAATCTTAACTGCCTGGACTTGGCTGTTAGTGATGGTTAAGGACAT
TCCAATGCTGCACTTTAATTGGTTTAAATGTTATTTTTAAGTGAGTACAATGAAGAGTTC
AAGCAGAAAATAAAATATAAGCATCTTGTTAAAACGGAAGAAAAAACAACCAGCTTTGCT
CAATGCACTGTGCCCTGCTTTAAACGTCAGCTGTTGCTGCTACAGCGTTAGGTGCTTCAA
GTCAGTTCTGACTCCACAGGGACCTTATGCACAACTGCTCTTGTAACATCCCTAAGTCAT
CACCATATCTGAGCTGACTGTTGAAGCCAGGGTGCCAAACCATTTATAACCTGTTAACTA
CAGCTTCAGAAACAATTTTTTGTTTCTATAATAAAAGTAATTGATTTTTCAATAAATTAG
TGGGTTTAAATGCACAGCCCCATTAATAACAAACATTCTAGCTTATACAGATTTTACAAA
ATGATTAGTTCAGAATTAAAACACAAAATAGCAATTTATTTTTCAGAGGTAACAAGGTTC
TATTATAGATGATTGGGATAATATCAAATAAGCATTTTTAGTATATAAACATCTTGAGAA
ACAAAAGTACTAGGAATGGGGTTTATGCAGTTAAGATAGAATTCTTTTTGTTTTGGTGGT
ATATATTTATAATTAATTTTTAAATCTGAAATGCCTAACATTTATTTCATTGATACTTTC
TCAAATTTGCTATATCCTACTGCTTCCACAACAATGAATGAATTTCTTTAATTCTCCCCT
TAAAAATTAAGTAGTGAAATTGGTAAGGGATTTATAATTATATTTGAGTAAGAAATTTCC
TACACCAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved