Echinops_telfairi Locus Mono:259:SNORA57
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:259:SNORA57
Echinops_telfairi
Mono:259:SNORA57
scaffold_226702
SNORA57
1001..1150
2150
CCCTGGGATGTTAGGACCACCATTGGATCCACACGACTTTGAACCCCACCCCACCCCCA
CTCTGGGCCTGTGGTCTTCCATCATTTTGCATCATTGCATGTGATTGTGTGAGTTTGAAG
AGGCACTTATGGACCAGTATCAGACTTACGGACTTGAGTTATTTTGGACAGGGATGTTTT
CTTGACATATAATTACTTCTTGATATAAAGATCTTTCTTACACCTATCTGAGTATGTTAG
ACAGGGTTCCCTAGAGAAACAAAACACTAATAATTTTATATATTTTTCTATAGATAGATA
GACAGATAACATAAGAAATAAGCAGTTAATGAATCTATAAAGCAGTACAAATGGCTCAGT
GCAACTCATTTCCATGAGACGGCGAATACACTGGCAGTCCTTCAAGTCTTGAGGGTCACC
GGGTAGTCCTCTGTAGAGCAATTCAGGCTATCCGGCCACAGGCAGCAAACAGCAAGGCAG
GTCACCAACAGCCAGCCAGATGACAGGATCTGACAGTCCCCAGCTCAAGAGATGTATATT
CCAGTAGATATAGATTTTTCAAGAGATGTAAGTTCTAATAGTGTGCTGAAACAGGTCTTG
AAGGAACCTCAAATTACAGTGACACAGTCCACGGGTTAGGTGTCCCACAGGTAGTGTAGC
TTGAAAATTGAGGCACAGAACAAACAAGGCAGCCTCACACTGGTCCGATCACCAAAGAGA
AAGAGACAAGAAAGGCGAGGCTCGCTGAGCCATTTCTTTCTCTGCCCTTCAATGAATCCC
GCATGTGTTCATTGGCCACGTTGGCACAATAAATCTATCACAATGAGTGTCCCTAGATTT
GTATCTCTAGTCAACCAGGCCTAATACATAGTCACTTCTTCTTCACTGCCTCTCAACTTT
CATACCCAGAAGAAGAAGAGAAAAAATAGTTCATTAAACTAGACAGTCTCTAAGGTCTCC
TTCTCCTGCTAATGTTCTCTTCTATAAGAATGCAGACTCACCCTCCTTTGCTTGGCGGGT
GTCCAGGCGTGCAGTCCCTGTCCCCGTTATGTACGGAGGCAGAGGGAGCAGACTCCGGAC
TCCTCAGCATCAAGTCTTTGGTGCCGGCGGCTACCCATCCTCTGGTTCTATCCTCAAACA
CCGGGACAAGGATGGGAGGGGCGGGGGAGATGCAGACTCAAAATGGTCCCTGTTTCCTTA
CTAAAAGAAAAGAATTGAAGACAGTACTTCAATTCTTTGCACATACTAGCCCCTCTACAT
GACTGCACGTTCCTTTTCATTTCTTGTCTCTACCACATATTTTGAGATGGGAAAATCCTA
CCCTGCTTTTAAAGTCCCAAATTAAATGACAAGCCTTATGAAAATCTCCTTGATCACATC
ATCAGGAGTTAATCTTCTCCACTGCAGCCTGATAGCACTTGCTGCTTGTAGGTTGACCTC
ATGTATGAGAGATGTCTATTGTTGTTAGGTACCGATGTTGACTCGGTTCTGTTCTATTTG
CCTGCATTTTACTGGGGGGTCGTATACAAGGGAATGAAACACTACCCAGCCCTGTGTGAT
CCTTACAGTCCTGATGTGTGCCTATTGTTGAAGTCACTGTGTTGATCCATCTAACTGAGG
GTCTTCCTCTGTTTTGCTGACTGTACTTTACCAAGCATGATCTCCTTCTGCAGACACTAG
TCCCTCCTAAAAGTACCATGCCCAAAATATGTGAGATGAGCTTTCACCATCCTTATTTTT
AACAAGTATTCTGGATGTGTTGCCAAGACAGGTTGGTTCAATTATCTGACAGGACATTAA
TTATTCTTCACCACTTCATAATTCAAATGCATCAATTCTTCTTGGGTCTTCCTTTTTATT
GTCCATTTTTGCATACATATGAGGCTACTGAAAATACCAAGGGTTGAGTCAGGTGCAACT
GGGTCCTCAAAGTCACACTGTGTTTTTAACACTTTAAAGGGCATCAGATTTTGCCCAATG
CAGTATATCCTTTAATTCCTTGATTTCTGTTTCCATGAGCATTGATTGTAGATTCTAGTA
AATGGGGTCCTTGACAACTTCAGTATTTTCTCTGTTTATCATGGTGTTGCTTACTGGTCT
AGTTGTAAGGATATCTATTTTCTCTATATTGAGCTGTAATCTATCCTGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved