Echinops_telfairi Locus Mono:158:SNORA73
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:158:SNORA73
Echinops_telfairi
Mono:158:SNORA73
scaffold_308639
SNORA73
1001..1205
2205
TAAAATTTTCTTCAGATTTCTTTCATGGAGTGAAAACAGGTACTGATAGGGGTAAAAGC
AAAATGGCATAAAGCAAATGATCAAAACTTCACGTTACACACTTGGCTTTTAAGAAAGAC
CTACAATAATAGTCCCTTTTTTGCTAAGGAAAATATTGAGTTGTTAGAAAGAAAGGAAGC
TTTACCAGAATCTATCCGCCTTTAGATATATGATAGTGAGACGGACTAATGAAAATTTAG
TTCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATCAATCTTTCT
TATATTGATATCAACAATAATTGCTTGTGCTCCATTTTTATTTGATGCATGGGAATCTGG
CAGTAAATAACATTCTACATTTAAAGATGTGGACATAACTTAAGTTTTTTTCATATTGTT
GGTGATCAAGTTACGTGATCTGCTTAAAATATGAAATGAAAATGCTTCCCAATAGACTAA
GACAATTAAGAACACTCTATTGTAGAGTAGCGTGAGTTTATATACACAGCATTTTCTTCA
TGACATTATTGAATGTTCTTCAATATGTATGAGTTCCAGTTAATGAGATCTACATTAACT
TTATTTTATGTAATAGGAATTAAAGGACATAAAGAGATTAGGTTCACAGTTAATGGCAAG
CATTGGAAAATTACTCCTTACCATATCCCTGGAAAAGATTACTTGGAAGTGTGGCAATTA
TGACCCTACCTTTCCTTCTGAAGTAGTGCATAAATCTGTAGTTTCTATAACTTTTCATTT
CTTTAATAAAGGCAGGATAACTGTCATACTGAGCAGATTTAGACAAGAATGCCGGGATGC
TAATTTGGACTTGATTGCTTTCCTACTAGTCTCGCTAAGTCTCACTAGTATGACTAAGAT
ACTGTTATCATCCTTGTTGCACAATAAGATCAATGAGTTACATGATCTGGATACTCCGGG
GAGGTCACTCTTCCCGGGCTCTGTCCAGGTGGCATGGAGGAGCACAGGACTCTGCCCCAT
GATATACGGTCCTGTTCCACAATGCCAGAGGTCCAGCCAGGCCTGGAGTCTGTACCTGCC
TATTCCTACAGCTTCTCAGAATCCTGCGGACAATGACTGAGGAGACAAACCATGAGGGGA
ACAGTCTCTAATACACCTTTCCTGAAACTAGGTTATTTTCTATTGATGAGTTAGACTTGT
TTTCAAATTTTTTTTCCAGAATGCTCGGAATCTCAAATACTGTTAAGCAATCTCAGATCT
ACATCTATACTCACAAGGAGGAAAAGAAAGAGCCTTTTTGTTTTTGATCCAGTTTAGCCT
TTGTTTTTTAATCCTTTATTTTTTGGTTCAGGTGAGTTGAATGCTTAAAAGACATCAACA
TTTAAATTCCACACTGCAGGTCATCACTTAAAAGATTAAGAGATGAAATTCTTTTTGTTA
CTTAATCTTTTGATTCCCCTTTCCCATGAACTTGCTGAATGTCCCTCTTATTATAAAATT
AAAGATTCTTTTTAAATATCTATAAAAAATACAAGTTACAATGTTTTCTCCCTAGCAATT
GGCAACACTTTGAAGAAATGATAATGGCCACAGTGACCCAAAGAACAAGAAAATGGATAT
AGATACATTCATATTGGACTGTTAACTGGTAGTAAGCAGGCAATATGTAACNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved