Echinops_telfairi Locus Mono:230:SNORA24
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:230:SNORA24
Echinops_telfairi
Mono:230:SNORA24
scaffold_190836
SNORA24
1001..1128
2128
GAAAGTAAAGGGTGGTGTCTCAAGACATACCCTCTACTAAAGGAGTTTTAAAGGTGCCC
CCAAGGAAACAAAGGGTGTGCCTTGGGTCCTATCCTCTGCTAACTCACTGCCGTACCAAC
TCATATAGTTAATGTTTAGGACAGGGTGGAACTGCTCCTTTGAATTTCTAAGACTAACTC
TTCACAGGAGTAGAAAGCTCCATCTTTCTTCCTCAAAGTACCTAGTGGTTTTGAACTTTG
GACATTTTGGTTGGTGGGCAGACACATAACCACTAAGCCAGGTGGGATCTTAATGATGCC
CTCGAGGAAACAAAGGGTGTGGCTTTTCCCACATCCAGGTCTGAATCCCACCCCACTCCT
GTCCATCAGCATAGGAGAGAACGCCCTCCAAAATGGAAAGTTCAGAATCATATTGTGTAA
GGAACTGCGCCTAGAAGGGCTATGCTAATCAACCAAGCTCAGCACCACTGGGCAGTCCTG
AAACTCTAGTCTTGATTTAGCAGCAGAGCACATTAACTGTTCTCACCCAGTCTCCCATCA
TGTTTAGAGACACAAATGTTTGCCCTAATTTTCACTGATACTAAGAATGGTCACATTGAC
TGAGCTATTTTGTGCCCAGTGGGACCCCTTGCTTTACACATTTTACCTCACATTTCACAG
TAACCAAATCAAGCAAATACTGTTATTTCTATTTGTGAATAAGATTTTTCAAAACTATAT
TGATAACCTAATTAATAAATGTTATTTAAATATCCCTGCCAGAGGGTGAATTTTAGATTA
GGTCTAGCTCTTTAGATGAGGTAAATATTCTTTACCTTAAAAAGAGTGGAGAGGAAAAAA
AAATAAACTTAACTGTGTACACATTTATTACAGCACCTAAAAATGCAAAGACAAAGTAAT
TTTATAAAGGTAAATCCATTTAGCATGTATTTATTGAGCATCTGTTATTACAAGGGGTTT
CAAAAAGTTGGGGATGGTGGATGGAATTAAATGGTACTTTAGTTCATGTATCTTTGGGAC
CTGTCGGCTGTGACAGTCTCCCTTTCTAGCCATGGAAGAGTATGTTCTTGTTTATTGGCA
GATTGACACTACGATTGGTATCAGATTCTGACTGGCACAAGTAGCATTCTTTGCTGTTAA
GCTGGAGTTTGTGTAGAGGGTGCTACTGGGAAAACTTCTAACTGAAGTTAAATGTTTCTA
GGGTACTGGATTAATTGACGGACAGAGGAGGGAAAATAAGATTTCAAGAAATCCTGATTA
ATGAAGCTTCATCTTGCATCAAATTTTATCTTAAATTTCTTTAACTGCTGACATTTGGAT
GGATATTAGTCATGGTTGAGAAAATTCCAGAACAGCACTTTAATTGACTTAAGTGTTATT
TTTAAATGAATACAATGAAGAGTTGCAGTAGAAAATAAAATATATGCATCTTTGTTAAAA
TTGAATAAAAGACTTGATTCATCTATAAAAAGAAAAGGTGAGAATGATGATGGCAACAAA
TGTACAAATGTGCTTAACACAATGGATGTATATATGGATTATGATAAGAGTTGTAAAATG
ATTAATATATATCTGGATAAAAGAAAATGTTCTGAGAATGATGATGGCAACAAATGTACA
AATGTGCTTGACACAGTGGATGTATGTATGGATTGTGATAAGAGTTGTATGAGCCCCCAA
TAAAATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGTGTGTAT
GGATTGCGATAACAGTTGTATGAGCCCCTAATAAAATGTTTTTTAAAAAAAAATTAAAAA
AGAAAAAAAGGAAAGACAGAATGAGGGGATGCAACCTAGGCAGGCCGGAGCCGCTGCTGT
CGCCATGACCCGCGGTAACCAACGCGAGCTTGCCCGCCAGAAGAATATGAAAAAGCAGAG
CCACTTGGTTAAGGGAAAGCACTGAGATGGCGGGCTTTCTGCTGCGGCCCACAAGCAGAG
GGACTCGGAGATCATGCCCCAGAAGCAGAACAAGGCAAACGAGAAGGAGGAGGAACCCAA
GTAGCTTGTGGCTTCATGTCCAACCCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved