Echinops_telfairi Locus Mono:31:SNORA64
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:31:SNORA64
Echinops_telfairi
Mono:31:SNORA64
scaffold_302709
SNORA64
1001..1131
2131
ATCCAAACAAATGAGTTAGAAAAGGGTTTCCAAGAATGAAATTCCAAATTTGGCAAATG
TATTAATTATAATGGAGAGTACTTTGAAGGTGATAAGGTTGTTTTGTAAAAGAAATTCAA
TACATAGCTTTGAAAAAATTTCTGGCTTTTTTGTGGGGTAGCCTCTTGTATTTTAAGAGT
CTTAGCAAATTATAATCAGCAAATGATAACATTGCTTTGTAAAATCATAAACTAACCTTA
AATGCACAGGTTCCTTAAAAATTGTCTTCTGATTGTTTGGATGTTTTTGTTGTTGTGAGT
TAGGTGTTGTTCAGTAAATTTCTACTTATAGCAACCGCATTTGATGGTAGAGTAGAACTA
TGTTGTGGGATTATTGTAGGCTACAATTTTCACAGAAGCAGGCCATAGGTCATTCTCCCA
AAGAGCAGCTAGAAAAATTCAAAATGGCAACTTTTTTATTAATAGTGGAGCACTTACCAG
ATGGACCACCAGAGCTCCTTGCTTTTTTAGTAAAGCGACCAAAATCATAACTTCCAACTT
TATCTTACTGAAAAATATAGTATAACCTGTATATTACCAATTTATGTTCAAATGGAAACA
ATATAGCCTTGTGAGACATAGGTACAACAATAATTCTTGACATTCTTTTACACCATTATT
CATTTGATTAATGAAGTATTTCTCTCCCCACCATATTATTTATTTATTTATTGTTCAAAA
AATTCTCTTCTGGATACAAACAGCTAACTATCCCAACTTATTGGGAGAGCTACAGGCTAT
TTCCATAGAAATATACATAAATGCTATTCTATGGAAGATTATCTGAAGCTTATATATGGT
AAGAAATGAGAACAAACTCCAAATAACAAGTGGTAGGCTTATAAACTGAACTGAATTAAG
CAGAACATACATTCAGAGAATCAAGCGACTTAACAGTATAGCAAAATCAGTATTCATCAC
ATTGCATGCTACAAAGTGAAAAAAAGTTATTAAAGAGTTTGGCTCTCCCTGTTCTGCATG
GTTACACCTGCCATAACAGGTGTGACTTTCATAAAGAGGAGAGAGAGAAAGGGTGCCCTC
AGGACCTCGGGCAGGCCTCCGTGGCCTGTCTCTTCCAGGGGGCACAACAGGCCCTGGGAA
CTGGTGCAGAGCAGCTCAGGGATCCGCTGACACTCACTCCTTGTCTCTCTGCTGGAAAAA
AAAAAAGAGTTAATATCTGGAGTCCCTGTGGGGCACAAGTGGTTAGCTGGTCCACTACTA
ACTGAAAAGTTGACGATCGAACTCTGACTTGAGGTGAATCACTAGTAAGTTTGGTGATGT
GTTTCCAACAGGGCACACAGCCTTGAAAACCCATGAGGCATTTCTTTTCTGAAACCCACA
TGGATTCATCGTGAATCAAAATCGGCTTGATGGCAAACAACAATAAGGGTGGGGCCAGAT
CATCCTAAAAATCTATTACATGTCCAACAAGAAATATCAGGTAGTAAAGGAACTGATCTT
ACAATATCTGGGCAGATGACCTACGCTGATCACCCGAAAATAAATTACACGGTACACAGA
GGAGAAGCTGAGTAATTACTGATCTAGAGAGAAGTGTCATGCGTGTTTAAATAACTTGAA
AGAGAACGCGCACAAAAGTTACCTTCAAATCACAAGAGGATTCACTAAGAATCACAAGTG
ATGATTTGCTGCAGAAGGCCGAAATCAAAATCCAAAGGATCCAGGGACATCGTGAGGCAC
AAAGGAGGAGAGGAGTCAATTTAACTTTGTCTGAAGAAGCGCAATACTATTCATTTCCTT
CTTGAAATTGTTTTTTCAGGTTAAAATGCATTTGGTTTAAATGGAGAGATTGCTTTGTTC
AATAAGTGGAAGAAACTAGTAATGAAATCCAATGGCTTCTTCCATACTTATTGTAGATAT
TGGAAGTTTGCCTAATCTGTGCCTGGATGTAATGAAAGCTTTAAGAAGCAGTGTGTACAT
ATTATATTATGAGTCTAAAAATAGCTTATAAGTAGAGTGAATGGACTACCTACTTTACTT
GTCTTTATTACCTGTAGAATAAAATATATGTATAATTAACTCTAGTTTAATTATGTTAAA
GGTGACCTGCAAAAAAAATCATAAATTTCAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved