Echinops_telfairi Locus Mono:603:SNORA44
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:603:SNORA44
Echinops_telfairi
Mono:603:SNORA44
GeneScaffold_4087
SNORA44
1001..1128
2128
GGTTTCCTTAGTTTGCCTTTGAATTACATGGTAATGCTGTGTTAGCAGGGGCACTTACA
CTGCTGATGGTTGAATTTGTAGGTAGGTTGGAACGGGAGTCTATGGTTCTTATTTAGCCC
TCCTTTAGTGCAACTGGCAGAATCCTGGTGGTGAGGTGGGTTAAGCACTGGGCAGCTAAC
TGCAAAGTCAGCAGTTGAAACCCACCAGTCATTCCACAAGAGAAATATGAGGTTGTCTGT
CTCATAAAGGTTTGTCATCTCAGAAAACATAAGATGCAGTGTTACTCTGTTCTATTGGAT
CACTGAGTCAGGACTGACTCCATGGCTTTTGCTTTCAGTGCAAGAGAGTAAGTCTTGATT
GTTCAGTGGTCCATGTGCTCGGGTGATAACTGGAAGGTCAATGGTTGGAACGTACCAACT
GTCCCAAGGGAAAAACACAATCTGCCTGCTTCAGGAAAGATCTGCCCACTGGGTAGTTTG
TGCTGTATCTTACAGGATCATCCGAGGTCATACTGGACTGCACTGTATGTCGTGGGGAGT
TAGTGCAAGAAGGCTTGAGATTTGTTCAATAATTTAAAAACTGCAAATGTAACAAGTAAG
GTGATTGTGATGAGAGATACTTTGCCAAGTAGAATCTCAGTTGCCTTGTCTCAAAGTGTG
GGAAATTAACACAACATTAAAGGGCAAGTAAACTCGGGGAAAATCAATTTGAAGTTGGTA
ATGGGAGACTCTCACTGAAATAAAAACCACAGATTCCTATACCCTTTGGTATATTAGTTA
CACTTTATCCTAAAGAAATAATTAGCATACACCCAAAAGTATAGCCTAAATTTAAAAGAA
AATTATGGCAGTTTTGAAAAACTTACTTCCCAACAATAGTGGTCTGGTTAGAGAGATGAT
TATCACTGACACATGGAAAAGGACACTGCTATTACAGTAATTCTGTAGGATGACATTTGC
TGATGAGAGGAGGGCACTTATGTATTTGTCGGGTGACTAACGGGTATGTTTCACATGGTT
TTGATTTTGTTTAAAAATTAAATGGCAACTGCATGCAAGAGCAACTTGGAGAGAATGACC
GCTCAGGCCAGCAAAGTCTCTGCAGCTGCCACCTGCCTTTCTATCACATTCTCCAGGATC
TGGACAAGGAAGCCGCCTACCTAGGTCCAGTTTTCCATCAGTCTCCATGTCGATCTGTGG
CTCGTAAAATAGCCTTGTAAAGTGATGACGCACAAAAGATCTAGAGTTTTGAGCACTGAA
GCACTATGGGAAGAAAGAACTTCAAGCAGGTCGTTTCATATGCAGCAGAAAAGTTTTAAA
CTGTACCTGGCTTAATAAAAAGACTTGTGGGAGTGGGAAATAAATATTAAATGGCAATAT
GGACACAGAAATCAAGGCTAGAAATTTCAAGTCAAAATGTTAATAGCAGTTTTCTCAGGA
TTGTGGATTTGGAGGATGTGTTTCTTCTTATGACGCCTTTTAACATAAAAAAATGTTTTT
TTATTATAATTAATAATAATCTATTTTAAATAATTGTTTTATTTTTTAATAATCAGTGTC
TTATCTTTCTAGTCAGAAAAATAAATTACTTCACTGTAATGATGTAAAGAACATTAAGTG
GTTTTAACTTGACTTCAGTGAGTAGGCAAGTCGATCTGTGTTCCTGCCCAAGGAATCTCA
AAACCCCAAACCACCTCACTCACTGCCACTGAGTCGATGGGGACTTACAGTGACACAGGG
TGGAGCTGCCCCTGTGAGTTTCTGGGACTGTAACTCTTTACAGGAGTAGAAACCCCCGTC
TTTCTCCCACTGAATGGCTGGTGGACTCGAATTGCTGACTTTATAGATAGCAGTCCAATG
TGTAAGTAACCATGACACCACCAGGGGCTCCTCACCGGAGAACAGTACGGCTTTATTCTA
TGGACTTTATTCGCCAACTCAACTATCTCTTCCCTTCTTACCCAACCCACCCATTTCTAC
TCATATTAAGCTATGGAAGGGTAGAAGGCATAACTCATCAAGAATGACAGGGGAAGTCAG
ACACCCACGGCAGAATTGCTCAACCAGCTAGATTTTCGACATCACAAGGGCTCCTTGAGG
TAAGAATTGGGGTGAGAAGTGATCTGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved