Echinops_telfairi Locus Mono:278:SNORD66
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:278:SNORD66
Echinops_telfairi
Mono:278:SNORD66
scaffold_198065
SNORD66
1001..1075
2075
TTCAAACAGAACAATGGGAAGCTGCATGGTTTAACATCAGGAAGGGTTGTAACCTTTTA
CTGTACTTATTTAATCTGTAGACTGAGAAAGTAATCTGAGAAGCTGGACTATATGAAGAA
CTCAGCACCAGGCGTGGAGGAAGGTTTATTAACAACTGCAATGTGCGGATGATACAACTT
GTTTGCTGAAATTGAGGAGTACCTGAAGCACTTGCTGATGAAAATCAAAGTCTGCAGTCT
TCAGTAGGGATTTCAACTCAATGTAAAGACCCAAATTCTCACAACTGGACCAATAGATAT
CTTCATGATAGACAAAATATTGAAATGATCAAGAGTTTTCTTTTGCTTGGATCTACAATC
AGTACTCTTAGAAGCAGCAGTCAAGGGATCCAAGGACACATTGTGTTGGGTACATGTGCT
GCACATGACCTCTTTAACTTGCCAAGGAGTGAGGATGTCACCGTGAGGACTAGCGAGGAC
AAAGTGAAGCCATGATATTTTCAGTGGGTTCACATGCATGTGAAAGATGGACAATGAGTG
AGGAAACTGCAGAAGAATTGATGCCTTTGGATTATGCATCACCACTACCATGGGCTGTCA
GAAAAACAAGCATATTTGTCTTGGAAGAAGTACAGGCAGAATGCTTCTTAGAATGCGTGG
ATGGCAAGATCTCATCTCACATTCTTTGTCATTAGGAGGCATGTTATTAGGAGAGACCAT
TTCCTGGAAAAGGACACCATGCCTGGTAAATTAAAGGGTCAATGGAAATGAGGAAGACCC
TTGGCACTATGGATTGCAACAGTGGCTGCTAGAGTGGGCTCAAATAGAACCATTGTGAAG
GTGATGCAGGAACAAGCAGCATTCCATTCTGCTGTACATGGCTTAATCTGAGTGGCATCT
GACCCTACCATCCCTAAAAATACCACCACCACCAAGAGCATTTATTAATATTTGAATTCC
TTCTCCCATGAATTAGAGGAAATGTACACTATCTTAAACCTTCATCATATTAACCTTTTT
TGGTGGGGGGGGCGGGGGGGAGGGAGTGTTACACACCCATCTGAGAATCTGAGGAAAGCT
ACTCATCTTCCATATTACACACTTGAATATATGCCCAACTTTACACAAACTATCTGGAGG
TTTGCACTTGAGGCATCCATTTTTATAGATTCTTTAAGCAGATGATGATAACCTGGCCTA
CAAATTCAAAACTTCCGAGTAGGCTTAAAAAAAATCTCATTAAGTAGGCTGTGCTCCAAT
TAAATCAGAATCACTGGGGTGAAGCTCATGCATTAGTATTTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCAAGA
AATGGAACCGCTCTCTGCATACATGGGGTTTCCACGAGTGGGACTTGATTACATGGTGAC
TCATTTCTTAGAACATGAACGGAGATTACACTAAAGCAGCCAGTGTGTAGTCAGAAGACA
CATTCCCGGGCTCAGTCCTAAGGGTCCATTTGCTCATTCTAGAGGCCCTGTCTCAAAATC
CTTCCTACTTATAGATCCTTTGTACTTTACTTGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved