Echinops_telfairi Locus Mono:486:SNORD89
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:486:SNORD89
Echinops_telfairi
Mono:486:SNORD89
scaffold_12148
SNORD89
1001..1115
1605
CTTTTAAGGGGGCTCTTACACATCTCATCACAATCCATACATTCATCCAGTGTGTCAAG
CACATTTGCACATGCGCTATTATGATTTTCAAAGCAATCTCTTCCCACTTGAGCCCCTGA
TATCAACTTAAGTTACAGATTATTATTTTTTTCCCTATATATTGTCCTCCGTTGCCCCTC
ACCCACTTTCCAGATGCTATATCTTTTGATAGCAGGCCACCATCAGCTTTCTTCACCACA
TTTGCTTATGCACCCATTTGAGACTTTAAATCTTTACAAATGCAGAAAGCCTCATCTTTC
TCCCTCAGAGTGACTGACAGATTCAAACCTCTGACCCTGAAGTTAGTAGCTCAAAGTATA
ACCCACTACACTACTAGGACTCCGAGGATCAAGGAGGGCAGTTATTGCTTCAGAGGTACT
TTTCTTCCTGTTAATGGGGGAAAAAATTAGGAAACATGTACACTATGGTGAACAAATTTA
ATGTTGCCTGCTTTATACTTAAAATTGAGATGTCAAATGTTTTGTTAGATATATATATCT
ACCACAATTAAAAATATATTCATTGGCCTTAAGACTGTGGATTTTTTTTTTTAGTATGGA
ACGTTTCACAAATTTGTGTGTTATCCTTGCGCAGGGGCCATGCTAATCTTCTCTGTATCG
TTCCAATTTTAGTATATGTGCCGCCAAAGCGAGCACAAACTGTGGATTTTAGATGCCACA
CAGTTTTTATTTTTGTTTTCAAGTTGAATGAGTTTGGTTTTTCGATTTCATTTTTCCCTG
GCAGTTTTATTGGCACATAATACACATATCATACAGTTCAATAGTTCAATCTCAATAAGA
TAGGTGTACCATCATCACCACAATCAATTTCAGAACATTTTCTTCATTCTCGTACACATC
CTTATTAGCTCCCCATTTCCCCCAAACCTCCCTCCCCATACCCCCAAGGAACCTATATAT
CATAGATTTCCTATACAGAAAATTCTTTAAAAACCAACAAAACTGAGGAATGATGACAAT
AAAAGGCCGGATTGCAGTGTCTCCATAAGCAGTTTGCTCTCTGTGTGGATGCACGATGAC
AAAACCTCCTGAAGCGAACCCTAGTCTGACCTCAGTATTGGCGGCACGCAAGCGGGTGCC
TTGGTCAAACTTGGCAGATAGGCGTGGCCAAGAAAGGCATTCCCAAAGAATTCAGAACTT
AAAAAAAGGGGGAAGGGGGTTAATTGTGATTTAAGTAAAGATTTACAGAGCAGATCATCA
GTTTTACATTCAGCAATTCATACACATTTTGCTTGAGCTCTCTCTTTGCAATCCTTATAC
CATGATTTCTCGTACTTCCCCCCAGTGTTTCCTGTTTGCTTTCTTCCTCCCTGCCTAAAC
CTGGAGACTTTATCTGTGGCCAAATACTGCCTTAAGAGCTTAAAAAAAAAATTTTTTCAG
AGCTAAAATTTTTTTTAAGCGTCAACATTGTTTTATAAAATTTGTGTTACTTTCTCCATT
TTACAGATGAATTTATAGAGATGCATAAAACAAAATATATACGTGAGAGCCTATAAGCCA
AAAAAAAATAAGAATAACAAAGTAAAACAGATAAAAACCTCAATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved