Echinops_telfairi Locus Mono:133:SNORA73
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:133:SNORA73
Echinops_telfairi
Mono:133:SNORA73
scaffold_294185
SNORA73
1001..1196
1556
CAGGACAGCATTCCAGGAATACTAACCACAATTACTCATAGGTGAACTCTATCAGCATC
TTCCCCATCTTCTTCTCAGCCCCGTGCAGGAAAAGATCTTTTGGTAGGAGTTAGAGACTT
TAGCTAGAAGAGCCACGTTAAAAAATTCACTGCTCCTGCAGCTATGAATCAGAACCAGCT
TGAAGACAATGGGTTTGGGTTTGAGAACTTCTGGAAGCAGATTGCAAGGCCTTCCTACCA
AGCTGTCACTGGATGGATTTGAACCACCGATTCTTCACTTATTAATCCAGCACTTAACTA
GCATTATGGACTCCTACCTCATTCTAAGCCCACTGGTAAATTTTATAAAGAACCACTGGC
CCTGACATGGATACTCCCAAGAGGTCATTCTCCTTGGACTCTGTCTAGGTGGTATGGAGG
AGCTCAGGGTTCTGCCCCATGTTGTACAGGCCTTTTCCACAACGTTGGAGATCAAGCCAG
ACCTTGAGTCTGTGCCTGCGCCTTCTACAGCTTCTCAGATTTCTGTGAGCAATGACTGTG
AGCAAAGAGACACAGCACGCGGGAAAGAGTCCTCTAATACGCCCCTGATGAATCTCGCTT
CTTGTCTATTGATGAGTTAGACTTGTTTTCTACTTTTTTGCAGAATGCTCAGAATTTCAA
ATACTACTAAGAGCAATCTCAAATCTACATCTATACTACAAGGAGGAAAAGAAAGGGCCT
CTCTTCCAGTTTGGCCTTTGCTTTTTAATCCTTCACTTCTGGGTCGGGTGAGTCGAATGC
TTAAAAGCCATCAAAATTTAAATTCCCACACTACAGGTCATCATCGCTTCATAGATTTAG
AGATGAAATTCCTTTGTTAGCTTAATTTTTTTACCCATGTACTTACTGAATGTCCCTCTT
GTTATAACAAAAAAATGCTGTTTAAATATCAAAAAAAAGAAAAGAAAAATTGGGCAGGCA
CCACTTTATTCTTTCAATTGAGATGACCCTTTCCATAGAAAGTGAAAATGCTTTATTCTC
CAATATAATCGACTGTACCTGGTCAGTGCCTGCATGTAGAAAGCCTGGCTTAGCCTATAT
TACTAATGAAGGTTCCCTCTCTCTCTTTCCCTGTACACACACACACACACACACACACAC
ACAGACGATATAGAGATATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved