Echinops_telfairi Locus Mono:531:SNORD99
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:531:SNORD99
Echinops_telfairi
Mono:531:SNORD99
GeneScaffold_2669
SNORD99
1001..1079
2079
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
GGGCTTGGGTGAAGAGCAGATGTTTTGAGAATGATGAGGGCAATGAATTGTACCATAATT
ACGCCTTTACCACAAATTGATGGTATGTTATGGATTTGTTGATAAGAGTTCGCATGAGCC
CCCCTAATAAAAATGATTTTTTTTAAGAGTTGTAAGAGCCCTCCAAATAAAAATGATTTA
AAAATTTTTTGAAAAGCCCTAACCACGCAAGTTTCTAATTAAAAAAAAAAAATCTAGTAT
CTCTTTTCCTCTGAAAAAAATACAGAAATACAGATAAACAAAATTCCAATTCAGCAAGAA
GGTTACTAAATTAAAAAATCAAACCCATCGCCACTGAGTCAATCCCAACTCACAGAGACG
CTACGAGCAGTGGTTCTCAACCGTCCTAACGCCGCGACCCTTTAATACAGGTCCTCATGT
TATGGTGACCCCACCCCCCAACCATAACATTGCTTTTGTTGCTACTTCCTACTGTAATTT
TGCTACTATTATGAATTGGGCGACCCCTGTGAAAGGGTTGTTTGACCCCCCAAAGGGGTC
ATGACCCACAGGTTGAGAACTGCTGCTCTAGAACAAAGCAGATTTGCCCTTTCTGGTGTC
TAGGACTTTAAATCATCATGGAAGTAGACACTCTCAACCTTCTGTCTGAGCCACTCATGG
ATCCAAACCACCAACCTCAGGTTCGCAACGCAATGCATCGTAGTGGGTTATGCACTTTAA
AATAGCCAAAATCATTTTAGTATGTTAGTTATGAAAAGCGTCTTTCACTCTGGAGTAAGC
CCTGAAGGAGGAGCGGGACGTTTCTTAGAAGTTGACACAAGACCTAGCAGACAGGCGCTA
TGGGGTCCTACCAATTTTAGTGAAAGTTTAAAGAGTCACATGTAGGTCACCTACTTTAAA
GCAAACAAGTGACATCTATGGATGATAAATGAGGATTTGGGACTGAGACCAGCTGCTCCT
GAGAAAATTGGGTGGGGTTTAATTAGCAGTACTGACACACTGGCTCACCCTTTTCAGCAC
TGAAGCATTATGGGAAGAAAGAACTTCAAGCAGACCATTTTGTATGCAGCAGAAAAATTT
TTAAATCTACCTCACTTATTAAATAAAAAGACTTGTGGGGAAAACGAAAAAAAGTGCTTT
ATAATTAAGAACATCAATTCCTCACCTGTCAAAAACATAACCTTTTCTCAATTTGTGGCT
GATGGCATTGGCTTCCTGAATCATCATGGAGAGTCTCAGGGAGCTCCAGTTCGGCTGAAC
CCCTACAGAAAAGATCCAAATACACAGAGGAGCGCGATCATATTTCACTAGACAGAACAA
TTGCTTGAAAAATGATTAACTTTAATTCTACTTAATTTTTAAATAATAACTAATTCCTGA
GTAATTTTTCTTCAACACTTATTGGTGAAATATTCTTTAATTCTGTAAGTGAAGCTTTCC
ATCCAACTGTGGTGAAATGGAAAAAAACTTAAGTTATAGAGAGGTTAAGGACTTTTTAAA
GAAAGGAGACATGAAACACAATGATTTTCTTTTTAATTTCGTTAAAATTGTGGTTCAGTA
CTTCGTAACTTCTTTAAAGTAGTGGGTAAAGCATAATACATACAACCTGATTTACACACA
ACCACCGTTTTTCATTTTGCTTAAAAATCACATTTTTTCTCTTAACAACAACAAAAAGAA
TAGAAAAAGAAAACAATTTAGTCTATAATTTTCATTTTCCTAATTAGAAATATCAGTATG
TTCAGAGCATGTTCTGTATTGTTCAAAACTTATACCTGAAATACTACACCTAAATCCCCA
CTTCTTGAGGAAACATGAGCCTCACCTTCACATGGATAACATATATATATACATATATAT
ATATATATGACAGACTAACACGCGCCACTTTAATGCCATCTCGTTGACTGCTGAATGACT
TGCCTCCTTTCCGCTCCCATCTTGGAAAGTCCCACTAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved