Echinops_telfairi Locus Mono:375:SNORA8
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:375:SNORA8
Echinops_telfairi
Mono:375:SNORA8
scaffold_239481
SNORA8
1001..1110
1394
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNACTGTGCTCTATAGCTAGATATACTGTGATCATATGTTAAGATTCTTTATGTTAT
AGAGATCATACACTCTATCGCATCCATACATATATCACTGTGTAAAGCACATTGTACATT
ATGCCTCGTCATCTCAACATTGCTCTCCACTTAAGCCCTGGCATCAAGTCAAGCAGTTGA
AGGTAACAAACAGACCTTCTATTCAGAAAATAAGAGCAAGGTTATATACTTGATCCTTGT
CATCTGTTTATGTCTTTAGCAGAGATGCTAAGGTTTATTTTGTGGATACTGGCTGGTCTT
TGAAAAAAAAATCAGCTTCAAAAATGTAGATCTCCTTGCCAGTTGTTCTGAATGTCTTTT
TTATCTTCGTGGGTCCACCCAAAGATGGATTATTCTTGAAATGAGCGATGGTGGATTATG
TGTTAGGTGCTGCCATGAAAACTCTGCTGGTGAGGTGAACTGGTGGCAACAGGTTCCGGC
CCTGATTTTTTTTTCTTTTAATGCAACCATCCGAAAAGCATCAGGACAAGTAACCGTTGG
CCTGCCATCCTTAGCATTTGTGTTTGAGGTTACCAATCTATTCTCTAGGAGATTTTTTAA
AAACAAATTACAGCTGGCCAATTAAAATGTATTGATAGAAAAGGCTATTGTTGATTATAG
TAAAAACTTAGGTCATTTCTGCAACACATGTTTATTGGATGTCCATTATGAACCAACGAT
GGTTCTAGGTGCGAGGGGTGCAGCAGTGGAGAAGATAGGCCCACAATGCATGGCATCTGC
GCCCAGACAGTGCTATAGAAATTCAGTATCTGACATCGTGGTGTTTTTTGGCTTTGCGCA
TGTGAAACCTGGTATTTTTATGGATGCCGTTTGTGTTAGACAGGGTTCTCTAGAGAGATA
AAACCAAATTCCTGATAATATAATATATTTATTTATAAAGATAATTAGATATATAATGAG
AAATGAACTGTTAAATCATATACAGATAAATATACAATACAAGAAGTAAACAGTTAAATT
AGAAAGCACTATAAATGGCTTAGTGCAACTCACGTCCATGAGAGAAAGTTGAGAGACTAG
CAGTCCTTCAAGTCTCTGTCTGATGCCAGATCATCGTCTATTTGTAGAGAGAGCTAGGCT
ATGTCAGCACAGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved