Echinops_telfairi Locus Mono:632:SNORA14
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:632:SNORA14
Echinops_telfairi
Mono:632:SNORA14
GeneScaffold_395
SNORA14
1001..1130
2130
ACCTTGGCCTTCATCACTGAAGACTTAGATTAATCACCAGATTCTGGTCCTCTCTAACT
GTGTCATCTTGGGGACAACCATGTAATGTCTTTGAATCCAGATCCTCATTTGAAAAACAG
GTATGATGTATGCTCTATTTTTGAAGGAGCTTTTTGTGGGGCTTTTTGGTTGGTGTTGTT
TTTTAGAGTCAACAGGAAGAGGGCATGTGAATGGATCTTGGGGACAGTGAAGTACTTTCT
AAGTGTAAGAATAAGGACAAAAGTGAAAACCCTGAGAGTCAGGGGTGAGCTTCCCTGGTG
GTGAAGTTGGCATCTGAGACGAGAGCACTGGGGCAGAAAGAGCATCAGAGGCACAAGCTT
CAGTCCAGGCTCTGTCATTTGTGACCTTAAATTCAATGACAGCACAACTCAGACCTTTAC
CCCGCCAAGCTGAAATATCAGGGAAACGGTGATGCCCCAAACTTCTGTGCTACCCAGGGC
TTTCCTTGTTCAGACAGAAGGTACCTGTTACTTGATCCTATTTATTGAATGAAACAAACA
AAACTCAAAACTCCACAAAACCCACTGCCATTGAAACAGTTCTGAATCATAGTGACCCTA
TAGGGTAGCCTACAACTGTCCCCTATAGTTCCCAAGGCTATAACCATTTAACCTTTGATA
AATAACAATTATAGCAATTCTTTCTTTATTTTTCAGTTTTAATGACTTATAATTCCCATC
CCGTACATTTTGATGGCTTAAACCTATGAACCGAGGCTATAATCTTTATGGCTGCAGAAG
ACTGTGGGATTCAAACTACCAATCATTTGTTTAGCAGCCCAGTGCTCAACCACTGCTGTT
TCCAAATTCCCCAGTGCATTCAAAAATGAAATCATGGGGGAAATTAGAAAGTATTCTGAG
ATCAATGACTATGAAGACACAAATATCAAAACTTAATGAGATACAGCAAAAAACAATGCT
TAGAGAGAAACAGACAGCAGTAAGATCAACATTCAAAAAGAAGGCCTTGGAACAATACGC
TAATTTATCTTAAGAAATTCCCAAGATCTGGGTGAATGCTACAGAGATTGCAGGCAATCC
AAAAGGCTGTGCAACCCAGTGGCCCGGCCTTATTTCACACCTGCAACATCTTGAGTTTCC
ACAATGTAGGAGGGCAAAGAGGAAAGGGGTAGAGGAAATGCCTACCAGAGGCCCCATGTT
CTCCACCAGCACAGGTGGGAACAAGAGGAGGAAGCAGGTAGGCTTGGAGGTGCAGTGGCA
GGATCTTGAGGTTCAATCTTCCGAGGAAATGAGGCGCCCCATGTTCTCCAGCATATAAAG
CACACGGGGCACAATTGCTGGAATAGAAATAGTTCTGCCCAATAATCCATGTATTAACCC
CCCCACCCCACACACAGGGGGATGAACAACAGAAACATGGGCAAAGGGAGACAGTGGACA
GTGTACGATGTGAAAATATTTATAATTTATCAGGGGTCCAAAGGGTAGGAGGGTGCAGGA
GGGAGGGGGGAAAAGAGGAGCTGATACCAAGGGCTCAAGTAGAAAGAAGATGATGATGGC
AACATATATGCAAATGTATTTGATACAATTGATGTATGGATTGTTATAAGATCTGTAAGT
GCACCCGATAAAATGTTGATTAATTAAAAGAATTAGTTCTGCTACCAGTGTGGGTCAGGA
TTTGGGGTTGGAATATCTCGAACAGCCAAGCACAGAGGCACAAAGCACACGGGCAGGCTC
TCACCTCTGCAGTGCCTAAGCCTCTGGTTTCTGGACTCCGTCTTGACTGGGGGTGGGGGG
TGTGGTGTGAAAGTACATCACTGTCTGCAAGTGAATACCANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved