Echinops_telfairi Locus Mono:439:SNORA16
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:439:SNORA16
Echinops_telfairi
Mono:439:SNORA16
scaffold_251750
SNORA16
1001..1134
1448
ATGTAAAAACTGATGATATTCTCTGTAACCCTTCACCGTTATTCACAATAATACGTTTG
AGAGAGAGGGAGAGACTGAGAGAGACAGAGAGAATCATCTCAAATTCATGGATTGCCTGA
AAGTAAAAGATTAGCAAAATATATGTATTATGCAAACATTAATCTAAAAAAGCAAAACTC
TGCATACTCCAATTAGCAGAATATTCTAATGGGCTATATTAATATCTGAAAAAGTACAGC
TTCAGAGTGAATAAAATTACTAGAACCAAGACAGATAGCACAAAATGACCAAAAAAATCC
AAGGGCTCAGGTGGAAAGAAAATGTTTTGAAAATGATGATGGCCGTAGCTGCTGTAGTCA
AAAAAGAGCCCACAGTGAGTTTTCCCTTGACGGTCACCGTTCAGTTTGCTATAACTGATC
AGGAAAAGACATTTCAGGAAAAGACATTCCCTTATCGTGTCAGCCATTACAGTCGGAGTG
AGTCCTTTGTTAAAACTGGCAGCACTCTGAACCAGCCACAATGCTGATCATGGCTTGCGT
GTACAGCACGCACAGTGAGGGCTGGGAAAGTCACTGGCCTGAAGCTTAATCAGGACTGAC
GATGAAGCACATAGCAAGGGCCACCTTGTGTTGAAAGCGGAAACGTATCGTGCCTGGCCT
CCAACCTTAGCTACTGAGGAGCGGTCAGGTCATCCGGGACAAAAACAAAATGAAAAAAAA
GAAAGAAAATGATGATGGCAACAAATGTACAAGTGTGCTTGACATAATGGATGGATGTGT
GAATTATGATCATAAGAGTTGTATGAGCCCCAATAAAGCGATTTTATTAAAAGAAAAAAA
CTCTGAACAATGTTAAAAAAAAGTTTATTCTGATTGTTTAATGGGTGCTTAAAATGTTTA
TTCTGATTATGCTGGGTAGAGTGTTTAATAGACGCCTATTGGATTCTGTTGGTTGATTGT
GTTGTTCAGCTCCTCTATATCCTTACTGATTTTTCTAATAGTTGTATTTGTTGTTAAGAT
GGGAGTGTTAAACGATTTAAAAGTAATTGTGGGGGTTGTATTCCTCCTTTCATCTCTATC
AGTCTTTGCTTCATGTATTTTGAGGCTCATTTGTTTGGTGCATACAATTTAGTAGTGGCA
TAGTTTCTGATGGATTTTTTTGGTCATTTTGTGTTATCTGTCTTGGTTCTCGCAATTTTA
TTCACTCAGAAGCTTACTTTATCAGATATTATTATAGCCCATTAGAATATTATGCTAATT
GGAGTATTCAGAGTTATGCTTTTTTATATTAATGTTTGCATAATACATATATTATAATAT
GCTGATGTAGAAATCAAACAAGACTTAATGCAAAAACATGGATTGGAAAATTCAATTTAA
AAGAGATTTCTCCCAAAATTGTTTAATAGATCTTCAGCAATTTAGTGCTATCAAAATAGT
GAACAGTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved