Echinops_telfairi Locus Mono:606:SNORA20
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:606:SNORA20
Echinops_telfairi
Mono:606:SNORA20
GeneScaffold_1235
SNORA20
1001..1130
2130
TTTCTACTTGAGCCCCTGATATCAGCTCCTCATTTTTGTCCCTTCGTCCCTGCTCCCCC
CACCCTCATGAACCCTTGATAATTTATAAATTATTATTCTTTTGTCATATCTTATACTCT
CCAACTCTTTTTAATATATTTAAACCACTAAATTATATGATACGTGAGTTATATGCCAAT
GAAGCTGTTAAATATTATTACCAAAAAAACCCACAAAGAGACAAAAAATCATAAAAATGA
CAAGCAAAAGCCTTGTGATTAATTAGGATCAAGTATTCATCACATCCCTAGAAAAACGGA
TGGATCTGAATGGTGGTGGTGGAGAAGAATAGTGAAAGTACCATGGACTAGCACAGGGAC
AAACCAATCTCTCTTGGGAAAAGTATGGCCAAAGTGCTCCTTAGAGACAAGGATGGCAAG
ACTTCGTCTTCCATTCTTTGGATATACTGTCAGGACAGACCAGTCCCTAGAGAAGGACAT
CATGTTGGTCAAGTGGAGGGGCAGCAAAAAAGAAGGCCCTCGTGGAGAGGGATGGGCACA
GTGGCTGCATCAGTGGACTCAGGCACAGGAACACTGGTGCGATGGCACAGGGCCAGGCAG
GGTTTCATTCTGCTGTGCACAGGGTCACCATGGGTTTGAGCTGAGTCAGGGGCACCTAAC
AACATTTGTCACATCCAGCAAGAGCCTGGTATTCTCCATCTGTAATACCCACTGCCATCG
AGTCGATCCCAACTCATGGTGACCTGATCAGACAGAGGAGAACTGCCTCCTAGGAATGTC
CGAGGCTGTCAATCTTTACAGGCTGTCCTTAAGGTTGGAGGTTAAAAGCCACCAGCCTCT
CAGCAGGAGACAATGAGGCAGTCTGCCTCTGTACAGACTGACAGCCCCAGAAAATCCTGT
GGAGGAAGTTCTACTCTGTTCTCTGGGGTGCTGACTCGGAATCGACTTGAGGGCAGGGGT
TTGGTTTGGGTGGGCAAAACAATGGTTAAAACACTCAACTGTTTCCCATTGATTTGCTGC
TATTGTCTGTCAGTGATATGAGCAGTTATACACATGGGATAAAATATATGAGACCCTTGC
AAATTGAGATGAAAATAATCATTTTCTCTCTTCTGCATGGCCTGGACATTGGGAAAAAAC
AACACTCAACTGCTAATTGAAGGGTTGGTGGTTCAAACCCAGCAGCCTCTGTGAAGGAGA
AAGTCAAGGTTGTCTGTTCCCCTAAAAATTCACAGCCACNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved