Echinops_telfairi Locus Mono:586:SNORA73
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:586:SNORA73
Echinops_telfairi
Mono:586:SNORA73
GeneScaffold_1662
SNORA73
1001..1182
1518
ACTAAAATATTTTCTTGTTAGCGTTTCTCAAAAAAACAAAAACCAGACAGACAATTGAA
AGGTTTGGGGGCATATAACCTCAGCACTGGGATCATCTTAGCTGAGATGACAATCCCCCA
GGATTCATGGATGCCAAGCTGGTAAAGTCCCTGTAATAGTGAAACCGTGTCAGCAGATAC
CACCTTTATGGGATTGTACTGTCTGTCCTGCAAGTACACAAAAGTTATGTTACACGCCTA
GAGCAGTTTCTCGACTCTAAAGGCTTGAGCAAAGTCTGTTCCAGGAGGAGAGGGTCTCAA
AGGGCCCGCTTGCTTTGAAGGAGAAAAAATGTGAATATTGGCTTCCAATAAGACCTTTTG
CCCTTTGGAGGAGCACAGGGCTCGGCGCCCCGTGATGTACAGTCCTTTTCCACAACGTCG
GAGATGAAGCCGGGCCTGGAGCCTGCGCCTGCATATTCCTACAGCTTCTCAGAGTCCCGT
GGACAATGACTGAGGAGACAAACCATGCAGGACACAGCCCTCTGATGCACCCCTCTGAGT
CTAGGTTCTATTCCATGATGAGTTAGTTAGATTTGTTCACAAAAAAATAAAGGAAAAAAA
AAAAAAAAAGACCTTTTGCCCTGGAAACAGGGCAGTTCTACTCTGCCTTTCTGGGGGTAG
CTACGAGTCAAGTGGACTCCATGACAATAGGTTTTGTTATCGCTACAGGCAGGAAAGACA
GACTGCAAGCTTGTGGTTGTGAAGCATTATAAGGAGTTCAGGTTGCCTGTAACTATGAGA
TTTGAAGTGTGAAGAGATTTTTTTTCACTGTAAAATAATTTTTCCAAGAAACCCCTTATG
ATTCCCCAAGGCATAGAATAGCCCCTTGCTTTTTCTCCTTGGGGGTTATGGTTATCATCC
TAGAGGTGTGATTCTTGCAAAACTTTTCTCTTTGGACTTTTTGAGTGGGAGATATGTCTT
CTATTCCCAAGTTTCTGTGAATTGTTGGAAGCCGTCTTTCTCACAATGATTCCACATTTG
TGCAAATATCATACACCCAGGTCCCTGAACTGTCTAGAAGGTACAGTGAGTCCAGAGGGA
AACATGTGATCCCATATGTATCGATATCCACATTTCATAACAAAATTTTGGAAATTTTCC
TCGATTCAGCATGTCTTCTACTGATGAAAACACATGGTGTTGAACAAACAAAAAAGGGTA
GAAAATAAACTGGTCATGAAAGGGTTAAGCCAGAAAACAATGCCTTGACAAACGCAGATC
ATTGCAGAGAGATATGAGTGCCCTGTGGAGCCACCAGATGGAGCCCTGGGGATGCTAATT
GGGCGAGGGCAGTCCTGTTCAAACCCACCAGCTGCTGCGAGGAAGAGAGGGAGGCTGTCC
GCCTCTCTAAAGAGACAAGGGTCGCTGTGAATCAGAAGTGAATCAATGGCTGTGGGTTAG
TTTAGTTGATGTTATTTTTATGATTTAAACAGAAGCCTCATTCACTTTTAAAATGTTTTC
ATGAATATTTGTTCTAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved