Echinops_telfairi Locus Mono:11:SNORA4
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:11:SNORA4
Echinops_telfairi
Mono:11:SNORA4
scaffold_284301
SNORA4
1001..1112
2112
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTGCTGTCATCCTGGTAATTCTCTTCAGCTTTCTTATTTATATTGAATGTGG
GCACACAGAGGTTGATGCTTCTCTCATAAATGTGTAATGATTTCCTGTTATAAAGAACAT
AACGTTGTAATATATTTGTACGTATTGACTCAGTTTATCTTTTACTTTTTCTTTATGTTT
GACATCAATTTTTAAAATGTGTCAAATGAAGACCACACTCCACAGTGGGCTATACCACTT
AGTATAGTTCGCTACAATTTTGTGGCCTACATTTTAAAAAATGTATCAAATGTATCAATC
GCATGTTGAAGTTTCAAACCCATTAAATTAATTATAAATAATTTATTGTCAACCACTAAT
TACTTCTTAACAAAGAATTAATAATTACAGTAACTGTTCCCCCTTTCCGTCTATTTTTCC
CCATCCTACTTTTAATTCTCTTCCCAAACTAGGTTTTCTTAATTTTTGTAGTAACCATCT
TCACACTCATCACAAACACACTGTTTCCTATGTTATTATTGCGTTTTCTTTGTCTTTTGC
TCTTGCATTCTTACAGCTGGTTTGTCAATTTTTTTTCGGGATTTTGAGTCTATGTAGAAG
AAATTTGATGACTTGAATTGGAACGTATTGGAATTTTTGCAGTGTCACCAAGAAAATATA
TTTACCCTTCATCTAGGTCCTCAATATCTTGCTTGCTTTACCATTTTGTAAAACGTCCCC
TGTCACTTCAAAATGATTATTATATATCAGTCAGTGGCCTGCTACTGTGTCCCTGGAAAT
GAGATTTAGATGTGAACGATTCCTAACAATTGTGTATGTACTACAAAGATGATTTCTATT
ACTCTACTATTTTCTCTATCCACTCTCTTCTTCCAGCATGCAATCTTGCTATTTTAAAGT
AGTTTTATTGGTATATAATTCACCAAACATGCAATTCAATAGTTCAATTATATTAAGAAG
TGTTGTGCATTCATCCCTACAATCACTTTCAGACCCCTTTCTTTTTTTTCGTACATACTT
CTTGGCATCTATATAAGTAATGTTAAGTGTTTTTCAAATGGTAGGTTTACGCTCGTGGTT
TATCCACCAACAGACATTTGATTTGAATTTCCAGTAGGGTTCACTAATCACCCTAGTAAG
AATGTATGTTGTTTTGGAGCATCCGTAGAACAAGGTTAAATGACAGCAACTGATTACCAT
AGTTTTCTCCTCACCCCCTCTCATCTAGAGAAAATGAAACCAGCTGAGGTGAGGCGTCCC
TTATCAAATTGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved