Echinops_telfairi Locus Mono:19:SNORA29
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:19:SNORA29
Echinops_telfairi
Mono:19:SNORA29
scaffold_282138
SNORA29
1001..1139
2139
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGTTACACTACTACAGAAAGAA
TAGCCTGAACAGGAATAGATATATGCACACCCTTTTTAATTGCAGCACTGTTCACAGTAG
CAAAATCCTTCTACATATATATTCATGTGTGTTGCAAACATGCATATATATGGAGCACAG
TGGTGACAAAGTTACAGAAATTTTTTACCCATTACCAATGACCAAATCACAGGGCTTGGA
GACTTGGGACCATAGGCTTATGGGACTACTAAGTCACTTGGCATAAGATAGTTTGCAAAG
AGAATGGTTTAGTTTCCTACTGGGGTCCTAAAAGCTTTAAAACAGCCATCTAAGGTGTGG
CTACCAGTCGCCCTTCATCTGAAACAAGAAAGAGTAAAGAAAATCAAAGACCTGGAAAAA
CATTAGTCTAAAGGACTAATGGGCCAGGAGAGCACCAGCTTCTAGTACATTGAAATCTGA
AGACTATATGGTGCCAATTACCACTATTGACTACTCTGAAAAGGGTCACAACAGAAGGTC
GTGGGTAGAGAGATAGAAATATATAGAAGAAAACTCAAATTCATAAAAAAGCCTAGCCCT
ACAGGTTTGATAGCTACAGGTAGAAGGGACCCTGAAAACTATGACCCTTAGTTACCTGCC
AAGGCTAGAAGTTAATTCAGTCCTATGGTTCAACAGTCAGCCAAATGATACACAAGGTGA
GCAATAACATCAGGGACATACACTATCCTTAGAAAAGGAAATCACAGGAAATTAAAAGGG
TAGCATTTGCTCAGGGGTACTTCTTAGAAGGCAGGAAAGAAGAATGTATCAAAACTAGGA
ACCCTTGGATGGAGTGGGAAGAATGCTGTTATATAGTGGGGACTGCAATCAGTGTCAGGA
AACAAAATTTATATGAATTGTTGAACAGAAAACAATTTTCTCTTCCCATTTGACTACCAC
TTCAACTCTTAATAATAAATTGTAGTGGCTATGCTTGTGGGATAGAGTGATTTTTGCCAT
GATCTGAAGAAGGAGGTTTATTGTGTCCTTCTCCTATATGAAATGGCTATACAGAAAATG
AAGACTCATTATTTTGACACTTTGTGCAATTTGATAGAGAATTTTGAATTGTTGAACAGT
AGGCCTGTTTTCTCACACGTGCCTTTAACAGGGAAACTGTGCGTTATATCAGTGAAAACG
GCATTATCAACATAGATGAACTTGGAAGAGATTGCCTCATTAATGCTGCTAAGACATCCC
TGTCCTCCAAAATCATTGGAATGTATCCTTGTGGGTTCTCAACCTTCCTAATGCCGCGAC
CCTTTAATACAGTTCCTCCTGTTGTGGTGATGCCCTCCCAACCATAAAATTATTTTCGTT
GCTACTTCATAACTGTAATTTTGCTACTGTTATGAATCAGGTGACTCCTATGAAAGGGTC
GTTCAACCCCCAAAGGGGTCATGACCCACAGGTTGAGTATTGCTGCTTTAGTCATAGAAA
AAGAAAAATCTTAAAAGATATAAGCCACTGTCAATAATATAGTCTCCCAAAGGGAAGAGA
TTATGAATAATTGTTTTCTTTCTCTCATATCTATGTATTTTGATGCTTTTACAAAGTTTA
TGAGATGATTTCAATAATCATAAAATTGTGTTTTAAAAACCCATTCATGAAAGGTGGGAA
GTATTGTTAATAATTTTGAGTGTGGATTAGGTTAATACAATTCCCGGTGACAGCTTTAGC
TTAGGCATGAAGACGTTCTATGCAGGCTCTGAAAAGTCTTAATTTAGCAGGTTGTTTTGC
CAGCAAGCCATCTAACTGCAGCATTTCTGTAACTTAACAACGTACTCACCTCTAGGCTAT
CAGTATGGAACTTCAACAGCCTCCTAATAAAGAGTTAACAGAATTCTGTTGATGCTATTT
ATGCAAGCAAAGACATTATAACAACGATGACTATCATTCTAAAGAATACAGTAAAGAATT
ATGTAATCAGCAGAAGTAGAAATTCAAAACTATTTTTGCTGAGTGGTATGGGTTTCTCTC
AATACCCATATGTGGACTATGCCAGTTAAAAGTTTGCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved