Echinops_telfairi Locus Mono:470:SNORA32
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:470:SNORA32
Echinops_telfairi
Mono:470:SNORA32
scaffold_98850
SNORA32
1001..1126
2126
TGCATGGAGCTAAAGCCACCAGAAGCCATATAAGGTACAAAATAACAGATTCCAAAGTC
GAGTTATAAATATTTTGATGAAGATTCCATGTGAGAATAGACCACATTGCTACAGCAAGC
AAGCTTCGCACTCAAGAGGAGATGCCAAAGACAGCCTTAGATGGCAGCACCAGGAGTGGG
TCTACACTGGTCATGTTCAGAGTCATCGCCATGGCAGAGTTGAGGAGTTTTGTTTGTATC
TCTATTAGGAGGTGGTTGCATACACAGCAGGGAGTCCTGGTAACGTTGTGGGTTACATGG
TGGGCCCTTAACTGTAAAGCCAGAAGGTTGAAAATGCCAGGCAGTCTGAGAAAGAATAAT
ATGGTCTTCTTCTCCCATAAGGATTTACAGCCTTGCAAACCCTATGGGACAGTTCTACTC
TACCTTATAGGGTCTCTGTGAGTTGGACTTGACTCAGGGGCAGTGGGAGTGAATCAGCAG
GTGAGCACAAAGGGAGATGGCTAGACCAGAGACAGAGGCCAGAGCGGCTCCCTTGTATAA
CTGAGTAGGACCATAATTCAGATAGAGTCAGCCTTACTCTCTTCATGAAACTTTTGAGTT
CTTTTATAGAGATATTGCCTCAGGGCCGGGACCACGAACTAGTGTCATGTTGTGGACAGC
ATGCCACTCTTGGCACTACGTTTTCCAGAATTCCTTGCATCCGACACCATCTGGCAGAAA
CAGTGTTCTTGGACTGAAATTCCCAGACAACCTCACTTCCTGTAGGAACCCTTCATTGAC
TCTGTCTAACTGGAGTTATTCTTTGTCTTAAAGCCAAGAGCGAAATTCTGCTAAGAGGTT
TAATTTGGTTGGGCTTGGTTGGGTTAACGTAAAAGGGGGAAAAATATGTCTCTGGAGACC
AAAAACGATGAGTAGAGTGGAGGGAGTTAGTAAACCTGAATATGATATGCTTTTAACTAC
AAAATGAGTACATTCAAATTATTTTTAAAAGCAACATCTAATGGTCTTGACCAAGGCTTT
TAGAATGTAGTTTCTGATTTGCTGTAGATTCCACATTAAAAAAATAAATTCCACTATGTT
TTTGTCTTCATTTCCCTGCTATAGCATGCAACCGGTTGAAAAGAGGTTAAACCTTTACTT
GTTTTGTTTGTTCTGAGATCAGCAGTAACAGACATATTAATTTAAACCCTCCATTATTCT
CTGTAAGCTTTATCACTGATATTTAGCGAAATAAAATGTGCTGAGGAAAGGGAAAGCAGT
ATCGTATATTAAAAATAGATCTCTAATGGTAATACTAAATAGCGCTCTATGTGCTTTCAC
TTACAAACAGTGCACTGGGTGGAATGCAGGAGCAACAGAAGGTAAGGAATTCATCTGTAG
GCTCAGTAGAAAAAACCTGAACTTCTAGGCAGTTCTTCTGCCAGGCTCTTTAAACTTGCC
TTTTCAGTCTGTCTAGTTGGTAACTCAGGTTCCTGAGGCTTGCAGAGGAGGAATGATTTG
AACTTTGCTAAATATAAGTAATAGGGAATTTTGACAGATTTTCATAGGAATGTAAAAAGG
CTCATGACAACAAGTTTGAAAATGAATATGCTTCTTGCAAGGCGAAAAAAGGGAAAACAC
CCTAGAAGGAAGAAATCATTTAATTCAGTATAGACAAAAACAAAACCCCCAAACCTCAAC
AACAAAAGCCTGTGGCCAGCTTTTCCTAATGTCTCAAGACTCGATGCTGGAAATGACTGT
GTCACACTAGGTTGAAGTAGCCTTCTTCAACATTTGAGTGATGAAAATGAGCCAATGTGG
GTGGCATGTGGGCGCCTTTTGAAAGGGAAGGTGTTAGAGTTGAATTCCTGAAACTTATGA
AAAATGTAGAAAGAATCAAATGGCTTCCAATTTCTACCATTTTGTAAGAAAAATGCCTCC
CTACCCCCAGTAAGAAGCATGTTGATGTGCCCATTTGTTGATTGTGGGTGCTGTTCAGTT
TGTCGATTCATAACGACCCAAGATGATAAAAGCTGCCCCTTTGAGTTTTCTTGACTGGAA
CCTTTGGGGAAGCAGATTGCCTCATCTTTGTCTTGAAGAGTGACCAGGTGGGTTCCCACC
ACCCGCCTTATTAGTCAGCAGCTGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved