Echinops_telfairi Locus Mono:171:SNORA26
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:171:SNORA26
Echinops_telfairi
Mono:171:SNORA26
scaffold_320793
SNORA26
1001..1101
2101
AGAAAAAAACTGGGGATTACAGCAGAGCCCCGGGTATGGGCACAGATGTGAATTGTAAC
GCAATATGGAACATAATGAGAAAAAGCATTCTTCCTTATCCTATTAATTGTAGGCACTAC
CAAATCATCAAGAATTAGTGACCCCTCCTGCCCTCCGGCTAGCAGTTATCTGTGTACTGT
AATGCACCATGACCGAAGCACGAGCTTAACTGTACGTAATGCTAAGAACTAGCTTTTCAG
CAATATCAATCTGAACTCTACCTGATCCCTTTGCAATTCCTATGACAAAATTTAAGATGA
ATGCACACATTCCCTCCAATAGGTGGATGGTTGAGCAACTGACCCAATGCAGTTGATGAA
CTCGTGTGGAAATTTTAATTGACGGTGATGATGACGGTTGCGTTCAATGGAAACTGCTTT
AGACGTGAGGTGGAATGACGAAAGCGGAGTGCAAACCAGCCAGGCTCCCAGGGAGACTAG
AGTAACGGAACACTGCCGTGGGATGAGGCCAAGCCAAGAAGGGAAAGGCACGCGTTTATA
TTGACAGGGAGGATAGTGAACTATTCATCGCCCCCACCACCGAAAATATCCTTTAATGCT
TCTGTGCTATCTGTATAATAAAGGTTATCTTTTAAATCAAAGCACACTTCTGAGCAAGTT
AGTTGCCCCTCACCATAAAACCTATAGGTGATCAATGCTGAAAGGATTCCTTCCCTTGCC
CACCCCACCCCCACCCCCCTACGCCAGGTTCAAAAATAGTGCTGGAATCCGCCACGGAAC
CAGCTCCCGTTATTCAATGTCAGACACATTTACACTCAATATGTATTAGCGATTCCTTGG
GTTGACTTTGCCTTTCTGTTGTCATGGCAACCCTTTCCACTGCCATGAGTAGCCCTGGGG
CCAGACTCTCTCACGCATGTCTAGGCCATTTCTCTCCTCACCAGAGCCCTGGTGGCACCG
TGGTGACGCACCAGCCAGCGAAACGAAAGGTTAGCAGTTCTGAAACCCTCTGGCGCAACA
CAGAAGGGTAAAGCGAGGCTCCATAAAGCCCAGAGACGAGGCCGGTAGAACTCCTCTTTG
GATCCTGTCTGGAGTCACAACTGAAAGAAAAAAAGAAAACTCCCTGGAGATGTGCAGCCT
GGGAAACCCCTCGGGACGCTCTGCTCTGCCTGCTGGGTCGCGCTGACTGCGTTTCGGTTT
CGTGCCTTCTAATAAAGCACTAGCCCGCATGGCCGGTAGCCGGTGCCCGGTTTGCTGCCC
TTCCTTCCTGCTTTGCAGATCTCCCTTTGCGTGGGTTGTCTTCACTGACAGCTACACCTG
ATTGAGATGGCTTAAAGGGACTCTATTCCACACGTTCCCCACATGTCCCCGCCGAACAAC
CAATCATCTTGTTCCTGAGCGCTGGGAACCATCACTGTAGGGGAGAGCCAAACCATCCTT
GGAAGAATCCGGACCTCAGAGTGGTTCTCTCGGCTGGTAATCACATGACTCTACTGTCTG
GGCTTGTACCCCTGCGGTCACAAGACTTTCACAAGAGCACAAGCTGGTAACTGGAGTCAT
CTAATAGTGCTTTCCATGAAACATGAGCTAGATTAGCTACCTTTTTGCAAGCATCAAATT
ACATTTAAAACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTAT
CAAGAAGTATAGTATCCTAGGTCATAAAGGTCTGAAGGTACTCACATGTCCTATTAGCTC
GAGAGCCACAAAGAGCCACATGGAAGATGCACCCCAGTCTGTGCTAATCTTTAACGTTTC
GAAGGGATCCAGTATAAAGCGCCGTCAGTACGAAAAAATCTTCCCATAGTGGATGATCGG
GCGGTTGCGGAGTGAACACCATAAGCTCATTTGTCGGCACGGGAGCTCCCCTTGCAGAGG
GGTCTCAGGGAGGAGACAAGCCAGTCTCGTTAACTTAGATGGAGGTAGCACAGGCTCAAC
ATAGCAGAAGTTATGATGATCGTATGGAAGTTTGTTATGAAGGAAGGAAGGAAGGAAAAA
AG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved