Echinops_telfairi Locus Mono:235:SNORA67
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:235:SNORA67
Echinops_telfairi
Mono:235:SNORA67
scaffold_200966
SNORA67
1001..1144
2144
ATTCCCCATCTCTTCACAATCCTGCAGCATTTTATGTTTATTATTTGGAGAATGCCTTT
CCAGTAGATTTCAAATGATTTGTTCAATCTCTGATTGTTATTGTTTTCTTTTATGGGAGG
AATTGTGTCCTTTCCATATTACATTTCTATGATCTTCAGCTTCTTGATCATTCAATGTAT
TATATACAATCTAATCCAATTTCCTGAAGTTTACCGATCTCCTATTTTAATTTTTACCTT
CCGTTTACCTTCGTTTATTTTCCTGAAAAATTTAGTAGCCTTTTAAATTGCGCCCTTGTT
CACATTCTTGAGTTCGTCCTGTTTTTATTTATGGATGGATGACTTCTTTACATATTTCTG
TGGGTCTTCATTTAAGTGTTCCTCTGTTCTTGGAACTGCATATATCCTGTGTTGCGCCTT
TCTGGTTTCTCATCATCTGGGACCTTCAGCAAAGCTGACTGCAGTTAGCTCTGCTTTCCC
TCTGGTCCCCACGGAGTCCACCTACAGGGCTGGCTCAAACGCCTGCCCTGCAACTGCAGC
TCCATGTGTGTACCTGCAAGCGGATGTTGAGTATTACAGAGCCAGCTATGACAAGGCATT
CAACTTGCAGATGAAACAATCTTGCTTGCTGAAAAGCAAAGATGGGAAGGGCTTGCTGAT
GCAGATCAAGGATTGTAGCTTTCAGGATGGATTACAACTCAATGTAAAGAAGACCAAGAT
CCTCACAGGTGAACCAATAGATAACATCATGATAAATGGAGAAAAGGTTGAAGTTGTCAA
GAATTTTGTGTTGCTTGGATCTGCAATCATTTCTCATAGAAGAGCAAACAAGAAATCAAA
TGATGGGTTTCATTAGGTAAATCTGCTACACAAGACCTCTTTAGTGAACTGAAAGCAAGG
ATGTTACTGATGACTGAGGTGCTTCTGACTCGTCATTACATTACATTTGCCTCATATGTA
TGGAAATTGAATAAGGAAGACTGCAGAAGAAGAATTAATGGATCCAAGATGAGTCATTGT
TCCAAGGGACCATCTAGTGCCCCTCTCAGGAAAGTAGCAGCTTGGGATAGAATATGGCCT
GCCCGTCATGTCCTTGGGTGAAAGGAATGCTCTTCTCCTTTTGCCTACATAGATTAAATA
AATAAAAAAATTTTAAAAGAAGAATTGATGCATGAATTGGAATGTCTAGAAAAATGCTGA
GCATACCACAGATCACTAAGAACATAAACCAATCCATGTTGAGAGAAATACAGCCAGAGT
GCTCCTTAGAAGCAAGGATACAGAGACTTAGTCTTCCATGCTCTGGACCTGTTGTAAAGA
GAGACTGGTGTCTGGAGAAGGGTGTCATGCTTGGTAAAGTGGAGGGGGAGGGAAAACAAG
GAAGACTTCACAGACAAGGATTGACACAGCGGCTGCAACTATGGGCTCAAGCATAGGAAT
CGTTGTGAAGATGGCACTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGAAG
GAAAGAAAACTGCTCCTAGGCAGTGATGTGGGCTGTAGAGGGTGGCAGTAATTTCATATC
ATGCTTTGGGCATGATTGCATGTTTTTATCCTTTAGAAGTTGTCTACCCAATTTTCCTTT
TTCCCTTCATCTCCTTGCCTCTTTAAATTTTCACGTTCTCTCTGCCCTATCTTTTTTTGT
TTTAAATAATCTTAACCCCAAGGACCCGGGTATTTGAGAGACAAAAAAGGGGAGCCATAT
ATGTTACATCTTTATATTTCTATTTCAGTAAATTCTTCTGAACGTGATCTACTTCATCAA
AAAAACAACTTGTTCTTAAATGAGAAGGTAGAGGGTTGGGGCTTTCTTTTCTGAAGAGAG
TCTGATTCACAATTTCTGGGTATTTTCTTTTCCTGGTATCTTCCCTGAAAGAGCCCTGAT
GGTATACTGGTGACACGCGGGCATGCTAACGGCAAGGTCCGCGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved