Echinops_telfairi Locus Mono:64:SNORA72
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:64:SNORA72
Echinops_telfairi
Mono:64:SNORA72
scaffold_284040
SNORA72
1001..1132
2132
CTTAAGGGTATCTATGGTTTGTTATGATCCACAAAGTCATATGCCTTTGTGTAGTCAGT
TAAACAAAATAAACCCTCCAAAAATAGAAAAGAAATCTTAAGGATTAGAGTAGAATTAAA
CAAACTGGAAAATAAAAGACACTGAAAAACAAGCAACAAGTTGGTTCTTTTAAAAGATTA
ACAAAATCGAGAGAACACTGGTAAGCTTAATAAAAGAAAAGACAGAAAAGGGAAATACCT
AGAATTAGAGATGAAAAGGGCAAGATCACAACACATCCAAATAAAATAAAAAGAATAAAA
ACACACAACTATGAAGACTATGATCGAGCAAGTTTGATAACACAGAAGAAATAGAAAAAT
ATCTAGAAAGACATCATCTACCCAAATTAATGCAGATGGATACAGAATACCCTGGCAGGC
CCATAACTAAAGAAGAAACAGAGTCCTAAGAAACTTCCAACTAAGAAGGACCCAGTACAA
TATGGTTTCACAGGCAAAGTAATACAGAGTCACTGTACACCCCCCCCCTCAAAAAAAAAA
AAAAGAATTACTCCCAATTCCTCCATTTCAGGAAGTAGCATATCACCAAGAACTAATCAA
CGGTACTGAAGGAAGAAGTTCAAACTGTATTGAATGCATTAGCCAAAAAAAGACTCCAGG
AATTGGTAGAATACCTATTTGAAATGTTTCAGCAAGCTCAAGAAACACTGGAAGCTATTT
GGCCGACCAAATAATGACTAGTTTATTTTTAAAAATACATTAGATGTAACTTTCATCCTT
TTAAAAGTGGTCAAGCAAATTGTTTTTCAATCCTCAACCATAGATAAAATTATTTTTTAA
AAAAAACTATGTTAAATACTTATTAAATGCCAACCACATTTTTTAGTTTTGGAAATAAAG
CAAGAAATAATATAGAAGGGTCCATGCGCTCAAGAATAGAAAATAGGAATTATTTAACCT
AAAAAAAAATAAAGATCATTCCAGAGTATAAGAATTGTCTTCTGCGAATATTCTCGCTGT
CCTGGTTTTGTGGTAGCCAGGGCAGGCTAACCATTCGCTATATTAAGACCATGCATGTGT
CCCCAGGCTGAGTTCTCTCCCTGAGCCTGGTTTTATCAATGCTGGTGATAAGTCTGCATT
TCTGTATATGACTGGTACTCTAGGGATCTTTGTTCAAGTTCAAGATGACTGTCTAGTGAA
ATAGGAAGTAACAAATGCGAATTTGCAGAAGTATGTCTAAAGTAGGGTGATTCTGCAATA
ATTTGTTGCCATTCATTAATGTAAAATTAAAAGAAAGAAAGAAAAAAAAAAAGAATTGTC
TTCATGGGAATAAAGTAGAAGGATTGTTATAGAGAATGCATATGTAGTGATGTGGTGTGG
AAAGATGGTGTAGATATCCCTAAAAAGGCGACATTTGGGCTAACACAAAATGTTTACTTT
GTTTAATTGACTATGCCAAAGCACATGACTGTGTAGAACATAACAAACTATGGATAATCT
TTAGATAATCGTTAGACAAACGGTGATTCCAGAGCACTTCATGGTGCTCATGCAGAACCT
GTGCATGGATCAAGAGGCAGTTGCTAACCTTTGGCAGCTCCTTGCTAATATATGGCAGTA
TATTTACAATATAATATACAGTGTACAGACTGTGTAACATACAGTCAGGTATAGAGTACA
GCAGGATATACAGCAGTATACCCAACTGGTGTTGGATGATCTTCAGCAACATTTTACTTG
CACGTGATATCAATGTTATTGTTCTATAGTTGGTCAGACGGAACCAGGAAATAGTGCAAG
ACTTAAAATCAGGAAAGTTGTGCAACAGGGTTATATGTAATTTGAGTGTTTTTCATTGGA
GCATATATGTTTATTATGGTTATGTATTCTTAGTACATTGTTCCTTTAATCATTATTCAA
TGACTGTTCTTGTCTCTCATGTTTCTATTTCCCTTGAAGTCTATTTTTTCAGTGGTTAAT
AGTGCCACACCCGTTTTTTGTGATATACTTTTGTCCAGTCTTTGATTTTTAGCCTGATTT
TGTTTTTGCATGTGTGGTGTGTTTCTTGTTAGCAGCATATTGATGGGTTTTGTTTTATTA
TCCAGTCTGCTACTCTCTTTACTGGTGTAAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved