Echinops_telfairi Locus Mono:338:SNORD86
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:338:SNORD86
Echinops_telfairi
Mono:338:SNORD86
scaffold_260574
SNORD86
1001..1086
1424
CTACCCTGGGCCATAAGTTATGTCTTTGTAGATAAAAAAGATGAGGTCTAAAGAGAAGC
AAGAGAAAGAGTATTACCCATTCCGTTAGATGATATTGGGAACTTCAAAAAGTTTGTGGA
AAATATTCATAATTGTTTAATTCCATTTTCTGGGAACTTTTTGAAGTCCCCTACTATAAT
ATTCAACTGAATAGTAAAGAGGGGTAGGTATTCCAGCTAAAGAGTGCTCCCCTCCTCCAA
TGACTTCAGCAACTTGAGAGCCTGAGAGATTGCAATATTAGATTCCTGTCTCTAGAGTGG
TTAGTAGACTTGCTTTTGCTACGAGATAAAATGAGAGATTGCCACAGTGATGGCTGACCA
GGGCCCCTGACCCATACAGGCTTCTGCTGTGGGAGTGATGGGCCAGCCCTGGTGTCTGAG
TGATTCCCAGGGCCTAGCAAAAGGGACCAAACTTCCAGAGCCCTGAAGACCAGGGGAAGC
ACCCCTAAATACAGACTCATTTTCCACTCCACCTTCACTGGCCGAGTTGCTGCCAAGAAC
AAAGGCCGCATCTCCGGATATCTGGCAAACAAATGCAGCATTGCCTCTCCGATCGATTGT
TTCTCTGAGGTGCCCATAGTGTATTTGGGGAAAAGCTTGGAGAGCAAGTCGAGGAGCGAC
TCTCCTTCTACGAGACTGGGGAGGCCCTTCGGAAGCATCTGGATGCGATGAAGGAGGCCA
GGCGGACGAGGCCGCTGTGGAGATGACTAGGGAGCTGGAGAAGCAGAAGAAACGCTTGAA
AAAGGCAAAGAAGCACTGGCTGCACTTGGCTTGAGTCTTGGGAAAACAGCTGTGCTCCTG
AGGAGTGTAAGGTCAGCGGGCAAGAGACCCGCGGGAAAGGCCCACAAAGAAGAACAAGCG
GAGGGCCCAGGAGGCTCCACAGGAAAATGGATTGGAAAACCCAGGTATCTCTGCTCCCCC
AAACCCAAGAAAAAGAGCTCTAAGGAGGAGCTGGGCAGCAGTGACCCAGAAGGGACGCCT
CTCCCCAAGAGGAAGAAACTGAAATCTCTCCCCAGAGAGGAGCCTGCCTGTGATCCTCAA
GAGGCAGCAAAGGACGTTGGGAGCATCCCAAATCTGCAGCAGCAGCCCTCCGCCAAGGGG
GAGCCGCCAGCAGTGGATCTGAGGAGGCGGCTGCTAGCAGCAAGAGCAACAGCACTAAGA
AAGAGAAAACAATTTAAAAATCAGCCCAGGAAGGTTCAAATGGACATTCCCTGGTGCGCC
CCAACCCTCTCCATAAAAAAACAACTCCACAACAACGGCAAACTGTTTATTTTTTTTAAA
TGGTACCAATCCAAACCAGAAGATATATATACATATCCAAATCATTAAACCCTCAGAATA
CATCTTCAAAGACAACAAAAAGTGCAGCTGCAAGTACGTAATAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved