Echinops_telfairi Locus Mono:115:SNORA57
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:115:SNORA57
Echinops_telfairi
Mono:115:SNORA57
scaffold_317021
SNORA57
1001..1154
2154
TATGTTATCAAAAAGATTGAAGCCATCCTGTGGGGGCGTGCTCACTCCGGGGCCCAGTG
CTGACGGGCTGTTTAAGCCGTCATTGACACATCCCACTCTCGGAAAGAGCCCCGCTGTGT
GATTAAGCGAAGCAAACTGGCAAGGAGTTGGTATGTGCCCACCATTGAGTCCATTCTGAG
TCAGAGCCGCCCTGGAGACCTTTTAATCCTCTAATCACTGAGCTTGTCATCTTTCTTTGC
ACGCGAAATTGTAGCTAGCTTTCTATGTCTTGGTTTCCAGTGGGGCTGTATGCATCGCAG
AGTGCAGGCAGATAGATAAATTGAGGAGCAAACTTTACATCAACTCGCCACATGTCCTAA
TCTATCAGAGAAAAGAATCCAAAATATATAATGATTCAGGCCACCCATTCAATTCTTATT
TTCCAGTCATGGTTGTAGTGGCCATTCCAATTTAAAAAAAAATGAAATTAGCACTCACAT
GATAGTGCTTTCAAAGTACAAATCAAAACAAACAGAACAGAATTTTAATTCAAAAGCAAT
TTTACCAATAGACACATGTGAATAACAAAGCAGTTAAACTGATAATATTCTTACTTCAGA
TACAAGGGCTGCACTTAATTTTCCCTTAGAGGTAATAACAACTTTTTAAGAAGGTGTGCT
TTTTAAAAGAAGCTTGTTATAAAGAAAAAATTTAAAAAGAGAAGTTCGGAAATGTAACTA
AATACATGATTATTTTGCTATAGGGCACCACTTAAAATCTTCATGTCCGTGAATATGAAA
CCCGTGAATCCTGGTGATTGGTCTCTGAAGGCCCCGTGGATTACAGCGGTAAATCACACC
AATTCTCGGATGGCACAAGACCTGACCGCATTTCCCTTGTGCGTAGAATCACCACTAGTT
GGGGACCAACTGGAAGGCAGTTAACAAAAACTACCACATAAATTACCCTCAATTCTTTCA
GCCTGGTAACCAAAAATAATAATTTAAAAAAAACAAAACACCCTCCTTTCCTTGGCCGGG
GCCGGACGTGCAGTCCTGGTCCCCCGTACGTATGGGGGCAGAGGGAGCGGACACCGGTCG
GTCCCCCTCCGTGTCATGTCTTTGGCGCCGGCAGCTACCCGTCCCCTGGTTCTATCCTCA
AACGCTGGGACAAGGACCCAGGAGAACAAAAGAAAGAAAGAAAAAAAAAGCCACACAATC
GTATATACACTGTCCTACGTGTATTTATATCCATTTGTTAATTTCAATACATTTGGCAAA
ATTGAATTTTCTTTATTTTGTAATAAAAATTCTTGGCAGCAAAGTCAATGCCAGCAACAA
AACATATAGTCAGTACGTTGTACAGGTACCAGGCCCTTTTTTCAAAAACTGGGAAATTGC
AATTGACTATATGCACAACAATAGCAGAGACATTATCATTTGGANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved