Echinops_telfairi Locus Mono:268:SNORA71
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:268:SNORA71
Echinops_telfairi
Mono:268:SNORA71
scaffold_38727
SNORA71
1001..1134
2134
ATATATGTGAGGGTGCCCCCCCCAAAAAAAAACAATTGTTTTTTTTCAAAGCTATGTAT
TTAATTTTTTTTTTTACAAAACAGCCTCTCCATTACCCTTTATACATTTATCAAATCTGT
GATTCCATTCTTGGAAACATTTTTCAAACTCATCTGTTTGGATGGCTGATAGCACCTTCC
TCATTTTTTTCTTCACCCCTCTGTTGTCATCAAATTGCCATCCTTTCATGTCTTCATTTG
CGGAAATAAAAAGAAGTCACACGGAGTGAGGTCTGGTGAGTCAGGTGTGTGGGGCAAGAG
AGACATGCTGTTACCAGTGCACTGAGATGGCTGTGTGAGCAGGTGCATTGTCATGGTGGC
AAAACCAGTCCTGTCTGCCACAAATCAGGCCTTTTTTTGTTGCACTGTTGTGCAATCTTT
TCAGAGCCTCTCAATAGAAAGCTTGATTAACAGTCTGACCTGGTGGAAGGAACTCCAAAT
GCACTGTCCCCCCAACATCAAAAAAAAAAAAAAGAGCATCGGGTGTTTTTTTTGGTTACC
CCCTTGTAGCTATCACACAACGTTTGCCAGTTCACCTTTTTTCAGGTGTACGACTTACTG
TGTGATTTTCTCCATTACCATCCATCCCCCTGGCCCTGGTAACTGCCAGTAGTCTTTGGC
CGTCTCCGTTCACTTTGTTTCATTTTGTATGTAAGTGAGCTTGCTCTTGTGTGACGGCCT
GGCTGATGGCACTCAGCCCACTGCCCTCCAACGCCACCCAGGAGGCAGCCCCCCATGGAG
GTGACTCCTGGTGTCCTTAGAGCCCCTGGATTCCTCTGCTTCCCAGTACTTTTTGCCCAA
AGTAACTCCTCCTCGTTGGAATAGTCCCCTGGGTGGAGGTCCTAGGGGGCTCCCTGGGGA
AAGAATGGGGCGTGGCTGTGTTCTTCCTAATTGACCTGTTCTACAGCCCCTGGCATCTGC
TTCCTTCCCTGGATCTCTCTGCCCGATCCCTTCCCATGGGAACCTGCATTCAAAAGGGAC
CTCGGACTGCCCGTGTCCTGGTCATCACCAATGCAGGGAGAGCGAGTGTGGAAAGCTGTT
TCCCGTGTTTGGAGGGTGTGTACCTGTCCCTCGCAAATGCTGGTGCTTTCACACAGTGCT
GCCTCTCTCCTGCCAACCCCTCCCAGCCGCGGGGCATCAGGGCCCCTGGGTGAGAGGCAG
CGGTGGGGGCTTTACAGCTTAGCCAGAGACCAAGCTATGTGTGTATCAGGGTTTCCATAC
TTGGGGGCCAGGAGGCGGGTGCTGAGGACTATAGAGCATTTGTCCTACTGATCAGATGTA
ATGTCTGTTTAAGGAGCCGAGAAGAATTCTGGGTAACAAATAAGTGCCCTCTTGGGTGGC
AGATGGTGATGGCAGAAGTCTTTCCAAGAGAGGAGGCTTTTTGGAGGGAGAGAACCTGGG
CGGGCTTGGCAGAGTGGTAGGGGACAGGAAAGTATTCCAGGAACAGGGAGTGGCACAGGG
CACTTGGGGGCTGGCGTGATGCAGGCATCTGCTCGGGGAGTGTATTGTCTCTCTGGAAAG
ACAGATGTGCAGACAAGCGCTGCCAGTGGGCCTGCTGAGAAGGTGGCTCTTGACGTCCAC
CCAGGTGTGATCGTGCTTCAGTGTGAGGTGCCCTTCTGAGCGAGCTCCTAAGCGGTCCCT
CTGTCCTTTTTGCATCTGCTTGCTTGCTCTGAAAAGGGCAGTTTTAGCTCTTTATGAGTG
TTTTCAGTTTCACTCTTTTAGAGACACGGTTTCCTTTTCGAGACAAGTTTGGTGTGAATG
AATGGTCCACTCATACCAGATGACTTGGGGCCCCTCTCACTAATGTCAGCCTGGGAAGGA
AGGGTTAACAGGTGGCGGGCAGACACCTGTCTGACATGCGCTGTGGCCTCTGCCACTGCA
CCGCTCCCTGAGCAGTGGATCATTGAAGCAGACTCCACCGAGATAGAAGCATGGGCAATG
GATGCTCTCAGGGTGATGCTCTGGGGTCTCTTGTTCCCCTGGAGGGGCCTCCTCATGGTC
AGTTAGCGTCAAGAAGCTAAGCTGGTCAGTGTTTCTGCAGATGTAATCCCAAGCCTTTGA
CTTTGTCTTCCAGGTTATTTGGAGTTGATCTCGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved