Echinops_telfairi Locus Mono:594:SNORD14
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:594:SNORD14
Echinops_telfairi
Mono:594:SNORD14
GeneScaffold_2136
SNORD14
1001..1090
2090
CCGGTGGGAGACTTGGTGTTTACAGGTGTGGGGAGTTGTAACACAAGATTCCTCCTCAG
GTGTGATCCTAAGAGATTCACATGGCGTCGCACAAGTGCGATTTGTGACAGGCAATAAAA
TCCTGAGGATCCTGAAGTCCAAAGGACTTGCGCCCGATCTGCCTGAGGATCTCTACCATT
TGATTAAGAAGGCTGTCGCCGTTCGCAAGCATCTGGAGAGGAACAGAAAGGTGAGTTCGA
GGAAGCCTGGTGCTCAGTAGAACTGCTGTTCAATTACTCAGAATAGAATGCTTTGCCTTT
TCGAAGGTGGCTTGGAGGACAAACTAATTAGCACTGGGCCGACTTTGAGATTTCCTTTAG
CATTGACTCCACACTACATTTCTGGAATATTACCTAGTTGTTTGGAAAAGTGGGGTACTT
GCTAAGTTGCTGATCATTCCCCTGGGAACCATTTCCTGATGGCGCCGTGTATTGGGTAGC
TTCGTTGGAGAAAGTGCGTGGCGATAATACATTTTGTTTTGTTCTGCTTGGCTTCCTTGA
ATTTTGCCACTTTCTAAGGATAAGGATGCTAAATTCCGGCTGATTCTGATTGAGAGTCGA
ATTCACCGATTGGCTCGATACTACAAAACAAAGCGAGTCCTCCCTCCTAATTGGAAATAG
TGAGTAGCAACCTTTTTCTGGATCAGTGCTATTTTTATGGTTGGGACAGAGCCTGTGTAG
GAGAAAGGGGGTGCTTAATTCTTGATTTAGAATGCAGTTTGGTACATTTTCTGCCAATGG
CCATATTATACTACAGTGCTTTCTGCTTGGCCAGGCCATGATCAAAACAGCTTGTACAGT
AGATAAACAAATGTGTACAAGTTTGTGTTCTAGGAAACTTTGACTTGTAAAAAAGTCACA
GGGCCACTGTTAACAGACCCCTGGTTTAAAGTCTTTTTTGCAGAATATATAAAATTGTGG
CTTCTGTCTCTGCATCCCAGAAGTCTACATTATTGCCTTGCTCACTGTGATGACTGACTT
CCAACATTCGCAGTTTCCACCAGAAGGGTTTCCCCCTTATGTTGTGCTATCTTCCTTGGA
TGTCTGAGTGAGCACCTTCACGGCTTTGAGCCTTATCAGTTGGGGGATTTATAGTTGCCA
TTTTTAGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved