Echinops_telfairi Locus Mono:119:SNORA38
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:119:SNORA38
Echinops_telfairi
Mono:119:SNORA38
scaffold_203058
SNORA38
1001..1128
1871
AAATGAGGACCTGATGCTGGGGGCTTAAAGTGGAGAGCAAATGTTTTGAGAATGATGAG
GGCAATGAATGCACAAATGTGCTTTACACATTTGATGTATGTATTGGTTGTGATAAGAGT
TGTATGAGCTCCCAATAAAACGATAAAAAAATTGGATGTTTCCATAAGATATACATATAA
ATATATCAGCATATATACCTAAATGGAGAGTTAATGGAAAAATAATCAGTACTTAAAAAC
AAAACAAAAAAAAGGTGCTATAAAATATCCAAGAAAATATTAGTTCTAAGTAGAGGTTTT
TTTTTTGGAGGTCTGCAAGCAAATCATATTCCTGACTATGTCTATGGGGAAGATAAAGAT
GTAAAGTGACTTGTGACTTTTAATGAAACATACAAAGTTAGTTATGTTAACATATTTAAG
CAAAATCATTGAAATCATTGAAATAAAAAGCTATAACTAAGGTGGCAGGAGAAAAGAGAA
AGGAAACCTTATCTACCTAGGTTAATAAAGGAGATTAAAAAACAAACAAAAGAACAGTAT
ATAAATAAATGCACAGAGAAAAATTTTAGAAATAAATCCAAACATACGAGTAATCACAAA
TTTTTATTGATTCAACCCACGTAAGTGAAGAACAGGAGCCCTGGTAGCCTATTGGCAACA
CATGGGCTGTTAATCACAAGGCCAGTAGTTCAAAACCACCAGCCCCTCTGTGGATAAGTT
GAGGCTTTCTACTCCTGTAAAGATTTATATTCTCGGAAACTCAAGGGCCTGTTCTATCTT
GTCCTGTAGGGTTGCTATGAGTCAGATTTCACTCCATGGTTGTGAATTGAAAAACAAAGA
CTACAAGACTAGGCAAAACTATCAAACAAAAACCACTATGTTGAATACACAGAGAACACA
CAACAGAAGAAGGAACATAAGCTTGCAAAGAAAGGATTAAAAGTGACGAATTAGGGAAAC
ATCAAAGAAAAGCTGGTTCCAAGATATTTACAAGCCCTCCCTCCTCCTACAAAGGCGTGT
CTGTGGTTCCCTGTCCTTAGACACGTAAGAATTGGAGGCAAAATATGGATTTGGAGAAGT
TTGGGGCCAGCTTGCTCCTCGCAGGCTCCAGCGCCCCCAGCCCACACTGAAAAAAAAAAA
AAGAAAAAAAAAAATACAAGCCCTCCCCACAATAAAACTTCAAAAAAAAATGGTGCCCGG
CTATCAAAAATTATAGCATCTGGGGTCTTAAAGGCTTGAAGATAATCAAGCGGCCATATA
GCTCAGAAGCAACAAAGCCCACTTGGAAGAAGCACACCAGCCTATGCAACCATGAGGTGT
CAAAGGGATCAGGTACAAGGCATCATCAGAACAAAAAATCTTACCATAGTGAATGATGGG
GGGAGTGCAGAGTGGAGATCCAAAGCCCATTAGCAGGCCACTGGAGACCCCCTTGCAGAG
GGGTCTCAGGGAAGAGACGAGCCAGTCAAGGGGCGATGTAGCAACGATGAAAAATACAAC
TTTCCTCTAGTTCCTAAATGTTTCCTCCCTGCTCCCACTATCATGATATGAATTCGACCT
TGCAAGTCTGGCTAGACCAGAGGCTGTACACTGGTACAGATAGGAACTGGAAATACAGGG
AATCCAGGGCTGATGATCCCTACAGGACCAGTGGTGTGAGTGGTGATACTGGGAGGGTAG
ACAGACAATGGGTTGGAAACAGGGAACCCGATTACAAGGAACTATATGTGAGCTTCCTCC
CTTGGGGACAGACAACAGAAAAGGGCAAGATATCACAAGATAATACATGTTATAAATTAT
CAAGGGGCTTACCACTGGATGGAGTAGCAGCGGAGGGCAGGTGAAAAATGCAGGGACCTA
ATGGCTGGGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved