Echinops_telfairi Locus Mono:267:SNORA2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:267:SNORA2
Echinops_telfairi
Mono:267:SNORA2
scaffold_197672
SNORA2
1001..1136
2136
AGAGAATCCCGTCGCCCAGGGACCCTAACCTTGGAGGGAGCTGCTCCCACCCACCCCAC
CCATTGTTTCTTTTCGTCCAAGAGGTGCCAGAGCAGAAGGAACATGCGACCTGGCAGCAT
CTCTCCCATTTCCATTCCTTCACTCCAGCGCCGGGCCTCCTGCTCAAGTCCAGGGTTTGA
TAACCCCCAAAGAGAATGAGCCTGTCCGGGGATGCTGCGGGCAGTCGGCAGGCAGGTGAA
CCATGAGTGGACTCTGAAGGGACAGAGAGTGCATAGCAGGTGTGGTGACCTCGGTGTAGG
TTCTACATTGAGCTTGAGCCCCAAACCTGGCTTGTGTTATTTGGGGCCTGTCACATCTCT
GGGGGCTTCTGGGGGTGCACATGACTAACTCACTTGGCTGCTGGTTCAAACCTACCCCCT
GGCTCCTTGGGAGAAAGACCCGGTGATCTGCTTCCCTAAAGATTGCAGCCTAGAAAACTC
TAGGAGACAGCTCTCCTCGGGGTCGATAATGAGTTGGAATCAACCTGTTGGCCACCACCA
GTCACAGGGAGCCTGGGCATTCTTCCTCAAACATGCTGAGTGTGGACGGCCCCCGTGGAG
CTCTGAGCAGTGCAAACGGCGGATTCGAGTTCAAGTTCACACAGAGGTGTTTTGGAAGTA
AAGGCGCACCCCTTGACAGCCTCGCTGAGCACAGTTCAGCTCTGAGATGGATGCAAGGGT
CACATGAGTCAGAGTGGGCTTCATGCAACTCATCGTGGGTCTTTCCTCCCTGTCTCCCTG
CCTGTGGGAAGAGCAGCGTGGCTTTATCCAGAAGACCATTCAACCCACTGCCCCAGAGTT
GATTCCGACTCAGACACAGAATTTCCAAGGCTGCAAATCTTTAGAGGACCAGGAGACACT
TTCTCCTGAGGAGTGGCTGGTGGGTTTGAACTGCTGACCTAGAGGTTAGCAGCCCAGCTG
GTAATCCACTAAGCCACCAGGGTCCTTAAAAATCCACTCGCTTGGCCCTGAATCAGGGCT
AACAGTTTGCCGAAGCTGTTGGCTTCAAGCAGGAACCTGAAGAAATGTCTGCCTATGGTC
TGCTGGCCATTTCAGAACTGGGAAATGTCATGGTCAACTCATCAGAAAGAAACATCTGAG
GGGGAAAAAAGAAAGAAAAAAGAAATCCGCTCACGGCTGTTGAGTGGATTCTGACTCACG
AGGAGAGAGTAGAGCTGCCCCATTTAGTGTTCCGAGACTGTAACTCTTTTGGGGGGCAGT
AGCCTCGTCTGTCTTTCGTGAAGAAATTGGTGGGCTCCAACTGCTGGCCAGCATCACCTC
CGACACCACCAGGGCTCCCACCAGGGCTCCCTCCAGGGTCCTGANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGCATGTGCAGCTCATAAAGCAGTGCATAATATAATA
TGAACATCATATATTAATCATCTCAATGAGCTGCTATCCGAGTCTCAGTAGTAGAATTCA
TGCATATATTAGCCACATCAGAAGTCAGATGTGAAATGAGTATCGTCGGAAACTACAAAT
TACACTGTAAAGATTGGTCTTTAATTACAGGCTTAATTAAAGACAAGAGGGATTGGTTTT
TGAAAAGGTCTACCGAGTGTACCCTATTTTGCACTGGCCAGATGGGCTGTTGGGAAGAAC
TCTCTTGTCCTGATAGAACTTCAGCAATGGTGGAGATTTTCACTAATTGAGTTTTGCTCA
GAAGGAGGCTCACCTGCCCTGTCAGTTGGAAATTCGGCACCTGCCATTCAACAAGAAATA
CCAAAGACGTTTATGCTCTTTGGGGAGGAAACGTTCACCCAAACAGAAGAGAGTGGACTT
AAAAGTAGTTTACATTTTACGTGCCCTCTCCTGGGAGAGTTAAAACCATCCCAGACTTTT
CTTCGATGCTTATATGCATATAGGAAACCCTGGCATAGTGGGTTCCCGTTGGACTGCAAA
CCAAAACCACAAGGTCAGCAGTTCAAAACCATCATCCACTTTGTGGGAGAGAGATGCGAC
TTTCTACTCCTATGGAGACTTACAGCCTCGGAAGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved