Echinops_telfairi Locus Mono:97:SNORA53
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:97:SNORA53
Echinops_telfairi
Mono:97:SNORA53
scaffold_292024
SNORA53
1001..1219
2219
TCTTTAACTTCCCTTCCTCTGTTAGATTTGTAAGTGGTTTGCCAATTTATGTCAATGAT
TTCAAAGACCAAACTTCCTGCCTTGTTTCTTTGTATTGTTTTCTGCTTCATTTATGTAAG
GCTCTAATCTTTATTGCTTCTTTGTTCTGGTGGTGGTAGCCTTATTTTGTTTCTCTTTTT
ATAATTATTGGAGATGTTTGGATAAGATATTGATTTTGGCAAATACTTCTTTTTTATGGC
GTGTATTTACTACTATACATTGACCTGTGCACACTGATTTTCCTGTGTCTCAAGGTTTTG
GCAAATTGTGTTCTAATTTTCATTTGATTCATGGAACTAAAAATGTTATTTCTTTTCATA
TGTAGTAGTTTTTAAGCAGAATGCTATTCAATTCTCATATGTTTTATTCCCCTCCCCCTG
TTTATCTTTTTGTTGATTTCTAATTTGAAAACATTTTAACCTAACAGTGTTTTTTGTAAT
GTTTTCATGTTTTTAAATTTATTGAAGCTTGCTTCATGATCTACCATATGGTCTATTCTG
GAGAATGTTCCATGTTCACTTGAAAAAAGTGTGTTTTGTGTTGTTGTTGATGGACTGTCT
ACATATGTCTATTGAGTTTAAATTGTTCGTGTTATTTTATTCTTCTGATTCTTTATTGAG
TTATCTTCCAGTTCTTTCCTCTCTGAAAGTGATATATTACAGTCTCCTACAATTACTGTA
GAGCTGTCCATTTCTTTATCCAATTAATGCATTTTGAGGCTTTTTCATTTGGGGCATAGA
TACATATTATGGTTATGTTCTCTTGATCAATTGACCCTGAAATTGCCCTCTTTGTCTCTG
ATACTGGAGTTTGCCTTAAAACCTAACCAAATAGAGAGAGAATTTTTTTTAAACCAGCAA
AAATAAATACAGTTTAAACAGGAAAATAAAATAAAACCATCAGACAGGCAAATAACAGCA
AGAAAATGAATTTAATGCTATAAGAACAAAATGACAACATGCTTCCTTAGATCCACCTTT
GTGGATGTTAATTTTGAACTGAGTTCTACTTGTAAACTCTGTGTTTCTTGTGGTTCCAGT
CAAAGAAGCATCCGGCAACTTTTTGGATGTACAGCCAAAGGTGCTTGAGTCATTAAAGAA
AAGAACAAAATGAAAGGATGGTAACATCAAAGGTATTGAGAACTGGTATAAAATGAGAGA
AAAAATGCAATTATCACAATTATATAGGGGATAAAATAATCAAAAAAGAATAGCAGAGAA
AGATATGAGGAAAAAGAGAAATAAGTAAGAAAGTGAAAGGTAGAAAAGAGGGAGAAGAAA
AGAAAGTGGAAATTAAAAAGAAGAGAGAGAGGGGCCAAAAAAAGATAATGAAAAACAAAA
ATTTTTAAATGTTCTAGCCAAGGAGCTCATGGGGCAGTTAGTCAAGAAGGAGGGTGATCA
GGCCTAAATGGAGTTTCTGTAAGCCTGTATGCTCCCTGGGTCAGAGGACTTGATCCCAAT
GTTGCCTGGGTGGACTCGGATGGTACCTGTGGTCAGGGGGCTGGTTCCTGCAAGGAATTC
TTTGAGGTCCAGAGCGTGATTGGAAGCGGGCTGGCTGATTAAGAAATGAGTTCTTGCCCA
TCCAAGGGTGGACAGTGGCCTTGCACTTTGCACTACGTCTGATGAGTGGGGTTCTTGCCC
ATCCCAGGGGTGGACAGTGGCCTTGCACTTGGTAGTATACTGGTCTGAGGAGGGGGCCGC
AGTGCCTCCAGACACAAAAGTTATACACCTGGTGCCTGATCCAGAGGCTCCACAGGAAGC
TGTTCTAACCTTAGGCAGGAAAGGAAGTGTGTTAGGATGGGGTGGAGGAGGGTCACTGCG
TGCAGGATCGGTAAACATTCCAGGTAATCATCCAAATCTGCTTCATTTGGTCTCTGGCTT
CTTTTCTATGTAGAGGCTACGTAGTGTCTCTGCCTGGTTTGCCATCTTACTGGCAGTCTC
AGCTGGAGACTCAGTCCAGATCCAAGGAAAATAACGTCTCCAAAAGTGGCCTAACCATGT
TTCTGTTCATAAAGCCTTACACTGAGCCCCCGCGCTTAATGCCTACTTCTAGTGGATTTT
AAAGCCATTCACCATGAGTCTCAGTTAAAAAAAAAAGGCTATTTTCTTGACTCCCTGGGC
ATAATTCATGTAAAAATTGTTGGCAAAGAAACTGCAAAGCGAGATGACTGACCACCCATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved