Echinops_telfairi Locus Mono:581:SNORA24
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:581:SNORA24
Echinops_telfairi
Mono:581:SNORA24
GeneScaffold_6020
SNORA24
1001..1131
2131
CCTGCCACTCCTGGGGAGGACGCTGTCTGCTCCCGTATCGGAACACTCGGGAGCATTTC
TACTCCGTCCTATAAACCCCAAACCAAACTCATCGCCACCGAATCGATTTCGACTCAGAG
CCGCCCTTATATGGCACTGTGAGTTTCCGAGTTTCGAACAACTGACCTTGAAGTTAGCGG
AGCAACATGTAACCACTACGCCATCAGGACACCTGCGCTCTGTCTTCTGGGAATCGCTAC
ATAATAGAATGGAGTTAATGGCAGAGGGGCTTGGCTTAGGGTTTGTAGGAGAAACGTCTG
AATTCGGGCGGGGACCAGAAACGAAGCCCACACGTAGTGGAAGGGTGCGGAGGATGGGAA
GACCGGCGGGGAAGGAGAGAGGAGAGAAACAGGGAGGGAACAGGAGGGAGAAAGCGGCCC
CCAAAAGGGATAAGGTAGCCCCCGGAAGGAGGAGGTAAACCGGAAGGAGAAGGTAACCCC
CGGAAGGGGCGGGGCGATGGCGGGAGCCGGGCGGGAGTGGAGGAAAAGCCTGAGGCCCGC
CCACGCCGGCGCGTCGCCGGAAGAGCGTCATCAGCGCTATAAGAGAACGTGCGCACGAGC
GTTCCGCCTTTCTCATCCGGGGGTCGTCGCTGCAGGACTTGTGGCTAGGTACCCGTGCTT
TTGTGCACTGTCCTATTGATTGGGTCAAGGGCCGAGGTTGAAAGCGGAAATGCAGGGGGT
CTTAGGCTACCGCCCAGCTGGCGAGCCGCAGTGGCGATTGCGGTCCTCCGGGTTCGCGGG
CGCAGGCGGCGTTGCACAGCCTCTTGGCCGCTGGGCGGCCACGTGCGATTTGGGGCCTGG
AGCGGCAAGCTGAAGCGCGTGAGACCAGTCCCGCGGGTGTCTGGAGATGATGATCAGAGG
AGTCTACTCTTCGTCGCTGTTAGCACCCAGCACGAGTTCTCTCCGGAGGGTAAGCGCTTT
GTGGTGGAGAATGCTAGTTGATGAGCTCGGGCCTTTCGAATGTCCATGTATCTTTGGGAC
CTGTCGGCTGTGGCAGTCTCCCTTCCTAGCCATGGAAGAGTATATGCTTGTTTATTGGCA
AAGCTGTAACCATTTAATTGGTATCAGATTCTGACTGGCACAAGTAACATTCTTAGCTGT
TAACTGGATGTGTTTTGAGTGGCTAATGGACAGACTTTTAACTGTAATTGAAATATTTCT
AGGGTGCAGAACTAACCCACGGACGGAGGAGAGAAGATACGGTACGTTTTATTTTTCTTT
TCTGAGTTATGTAACTGCATTAGCTGTGAAGTCAGTTGGCTGAGATATAACTAAGTTGTA
ATTGTTGGGGTGTTTTTTTGTTTGTTTTTTTCCCTCACAGATCCCAAGAAAGCCCAAGTG
AAGAGTCTTAAGCAACTTGGATGAAATTTTATTTTAGATCTGAACTTCCTGGACTTGGAT
GTTAGTGATGGCTCAGGACATTTCAAAGCCGCAGTTTATCTAATTGGTTTTAAATGTCAT
TTTAAGTGAGTACTTTAGAGAGTTCAAGCAGACAATAAAATATATGCTTCTTGTTAAAAT
TGAATAAAAGACGATTTCATTTGTATAACCAGTGTCCTTTGCATATTTAAGTAGTCGGAG
ATAATGACTCCTCTTATCTCCTGGTAAGAGCATGTGGAATTAGTGTTTATATTGACTATT
TCCAGCGGGCAGTACAACTCGGCTCTACTTGTATAAATGTTGAATGCCTAGCACTGGTTT
GTAAGGTCCACCTGTAGAGTATTAATGTTTTTTCCAAACCCTTGGGTAACACTGTATATA
CCTCCAGGGTATGGACTCAAGGAAAATCTTAATACTGTTATGCCTGACAATTTTTGCAAG
ATACATAAAACACTTTTAGATAACACCAGTATACATTGCAGGGCTACAATTTTGACACTG
GTGGAGATGATGGTGTATTTAGAATAATGGCTTATAGAAGATTGTTCACAAATAATTGGG
GGATTACACTTTATAAAGTACACCTTACATAATCACAAATTTTAATATTTTGTTGCTCTT
GAGTTTAAAGGTAAACACCAAGGGGAAAGACTGCAGACAGCCAACAGCTAAACCATTTGT
ACATTACTGTAAAATCTTACCTGCCTCCTTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved