Echinops_telfairi Locus Mono:630:SNORA65
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:630:SNORA65
Echinops_telfairi
Mono:630:SNORA65
GeneScaffold_9076
SNORA65
1001..1124
2124
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGTGATTTCATATTTACAATCCTG
CATTTATTTTTGGTGTGTTACCGCTAGAAATCTCTGTTGTGGTCCTTTGCACTAAAGTAA
GATAGAAAGATCTTAAAGGGAATGTTGGCTAAGAGCCTTCATTAATATGAGCTTAAAGAC
ACGTGTGAAGACGTGATGTCCAAGATGGCTCCAGAGTCCCAAGGCAGGACATGAAGCTTC
ATCTTCCTTGTTTATGGTTCAAGATTTAGCTGGTTCATAAAAAAGAATATCTGAATTCTT
GTTGTGAAATAGTAGTCAGTTGCTTAAACTTTTGTTTTTAAACTTAATTTCTAAAGTCTT
ATAGGAACATCTACCCATATTTCTGACTAAAACTTTCTGTTGAATCTGATGTGTTCAGTT
GCTCAATATCATTTCAACAGCATTTGTAGCAAAAACTGCAGAAATCAGGAAAATGTTACA
CACACACACACACACACACACCCATTGTGAGAATTTAGCAAAAAAGTCTAATCATTATTT
TTATTATTTTGCTGGTTGTGGTATCTATTTTGAACAGTTGTATATATTGTAGCATTACTT
TTCTATATTATTGTGATATTATATTTACATTCCATATGAACTATGTACTTTATAACTTAA
TGATTATTTATTACATATTTGGTTTAAAATGTTTATGTGAATGGCTTTTTATTTAAGACC
CAATTGTATTAAACAATACCGAGTCAGTACCATTGTCTTTTGTGATTCCCTGCCAACCTT
TAATTCAATGGTCTCAGCAGAAAATGAGAGACCGTCCTTTTAGTTTCTGACAGCATAGAG
TTCTTTATAAATCTACTGTCAGGTGAGCTGAGAGTAAACCCCAGCTTAGGAAACAGGGGT
GTTCTTCATGTGGATGACTCTGTGCCGAAAGCATGGGGGACAGTACAAAAAAAAAAAATC
CACTGCCAGGACTATCTTCTCTTCTCTTCTTGCTCTTACTGAAAGGGACCTTTCCACTCC
CTGCTCCTACTATCAGGAGACCACTTCCTTTGCATGTCCAGAAGTTTCAATGATCTTTTC
TAACCGCCGCTGCCACCCTTACTTGAATACATGTGGAAAACTCCCTCCTGCTTAGAGGTT
TATCTCTAGATTCTCTGTCCTTTCCATTCTTGTCACTGACGGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved