Echinops_telfairi Locus Mono:487:SNORA69
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:487:SNORA69
Echinops_telfairi
Mono:487:SNORA69
scaffold_237683
SNORA69
1001..1130
1800
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGAGAAAAAGATGGCTAAAGATACTCACACAAGCAAGCTGCAATTACA
GTACTTCTGTTAGTGGAAGTCCTGCCATTATCCTACTGAGAGAAAAAGCCATGTTGGCCG
GCTCTGGTTTGCCTCTTCAGGTGAGATCATGACCAGTTAGCACATACAATTATGAATAAT
AATCATAAATAAATAAATCACACATCCGATGATGTTTAGTTAAAAGCAAAGAATATGGCA
AGGGAGGCCGCCAATCAAAAAGCAATATGGAAAGGTCTCAAATAACAGTCTTATTGGTTT
TTTTAAGGCATTATTTAATATTAAATATTTAATTTTTCATTAATATTTGAAAACTCATAA
CATAATCTAATTTGTTATTTTATTGTAATTTGTAAAATTTTGTTCTTATTTAAATATTAA
CTGCATGAAGTAATAAGCTATCTTTTAGTATATCATTTTTTTATACTTAAAACAGTCATT
AGGGCAGCGAACCGGATGTTAAATTATTTAAATCCCACCATTGCATTTAATCCTCCAAAC
AGTCTTGTTAATAGGAAACCGAGGAACAGAAAGATCGAATAACTTACATACACAGTTTCT
GCCGTTTGTGAGTGGCGGGGAAGTCATTGACTAGAGTATAGACAAGTGTTAACTTGGGTG
AAAGAAGACAGTATACAATAAAAGGGAGATTAGGGGCTACAATGATGAAGGCAGGGGGGA
GACCTGCAAGAATAAAAGGCCACCGGGGGAAATACTGTTTTATACACAACCTGCAATTGT
GGTGACCTATGAGGAGGAGCTTGGATAGGCGTGCAGGCTGAGCAGGTGTGCGAGGGAGAG
T
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved