Echinops_telfairi Locus Mono:208:SNORD81
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:208:SNORD81
Echinops_telfairi
Mono:208:SNORD81
scaffold_32024
SNORD81
1001..1085
2085
TCATACGCAGTGTGTCAAATCTGTTCTTGATATGCACCTGAAATTCAGGTGAATGTACT
CTAAACATTCTTTGGCTCACATAGATTTATTTAAATTTTCTTCAGCTAGCACCTGAACTT
AGATATGAACAATTGTTGGTCTTGTCCACAATTTGACCTTGGTCTCATTTTGCCTAGTGA
TCGTGAGCTTCTCCCTCAAGTTTCCCCATAGATGTAGTCAAAGTTGATTCCTGGGTTCCT
TCTTGTGAGGTCCATGTGAGCTACCATTTATGTTGTTGAAAGAGGTTTTCAATGAAGAAG
TTTTGTTCTTATTGTTATTATGTCCCATCAAGTTGGTTTTAACTCACAGTGACCCCTGTG
TACAACAAGAGTGACCCCTGTGTACAACAAGAGTGAACACCCCCGTGCCTGTGCGATTCT
CACAATTGTTCTGATGTTTGAGCTTATCAGTGTAGCCACTGTGCCAATCCATCGTGTCAA
AGGTCTTCCTCTTTTTCGCTGCCCTGCTACTGTCCCAAGCATGATGTCCTTCTCCAAGGA
CATCTCTCCTGATAACATGGTCAAAGTACTTGAGACTCACCATCCTTGTATCTAAGAGCA
TTCTGGCAGTATTTCTTTCAAGCGAGATTTGTTTGTTCTTTTGGCAGTCCATGAAACTTT
CAATATTCTTCACCGGCACCACACACCATACTTTACATATCTTGGTCTCACAAAAATCGA
TATTAAAATCTCTAGCTTTGTTTCTATCACCAAAGCCAGATTTTCCAACTACTGATGCTT
TATTTTTGTTTCCAACTTCTGTATTACAAGTCCTAGGACGTGTCAATGCTCCTGAATGCA
CGATCGACCGATTTAAGACTGAAAAAAGATGGAGGAATCCCTTCAGTTTTTTTCATCACT
AGCTTTAGTGGTTGTGTGTGACTTTGAATGGTCATGTAAACTGGAATTCTCTGTAGGAAA
TAGCTAATATTCTATGACATCAATGTACTTCAAAAGAGTACTTAAATACATGATGATCTA
CCCCAACTTGAACTCTCTCACTGATAACTTGATGATAATGGGAAGGAAAAAAAAAAGAGT
ACTTAAGATGTACTTTTTGACAATGAACGTGATGAAATTTCTCTTAAACTTGTCATTTTT
GACATAGTAACTTTATGATGTTCTGATTCTAAATGGCCAATACCAGTCGATTGCAGCTCA
TTAGTAATTACCCTATCCAATTTTATTCATTCTTTTTCATTTTTTATGACTTCCAATTTT
CCTATATTCATACTTTGTGTATTCTATAATTGGATTAATAATGAATACTTACACCTGTTT
CTTCTCATTGTGAGTCATGCCACCTAACAAATGACAGACCCGAAAGCGTGACTCCATTGA
CATCGTTATTAATGACACGACTTAGAGAAGGCTGCTCTTCGCAAGCCCTCCTTTGAGTAC
CTCCTTATTTCAGGGTCTTGTGTTCTGCACTATCTCTGACAGCACTTCCTTGCTACTCAT
AAGGTTTTCAGTGACTAAATTCTCAGTGCCTGGCAGTTATTTCACCTTTTGACACGAGCT
GATAATAATATACTTCTATTCATCAGGTTTTCAGAAGTGGACAGTCTATTTCTTCTTCGT
CATCTGTTCCTAGAATGGAAGCTTTCCTGTAAACTGTGCATCTTGGGTGGTCCTACTACC
ATATGAAGTAACAGTGACATAGCTTCTAGTGCTGCAGCAACACACAAGCCACTACAGCAC
AAACAACGGACAGGGAAATGATATTTCCCATCCCCTGTAGTCTTCTTCTCACTTCAGCTT
GGTGACTGTTCATCTAAAACCAGTTGGAGGTGGTTGAACCAACTCTTCAGTGATAAAGAG
AATTTCATTATCTTCCTGCTGTGAAACATTTTTAAAAGAACTTTCAAGTATTTTATCCCA
TCCTACATTATCCTATGAATCTCTGAACAAACCAAAATCTTTCTTTAGCAATTCATTTGT
TAAGAGGTGAAAACATACTGTAGAAAACCTGAGCTATCTGAAAATTTTTAAAAATCTTTT
TTTCCATTTCGAGATAAATTGATAAAACAGAATACATATGATAACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved