Echinops_telfairi Locus Mono:156:SNORA61
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:156:SNORA61
Echinops_telfairi
Mono:156:SNORA61
scaffold_307549
SNORA61
1001..1121
2121
CAGAGACATCTGCGGGGCTGATCCCAATCCTAATTATGTGGACAGCCCTCCCTCCACAC
AGAAAAATTCACTTCAGAGAACAGCACTGAAGCTACAGCCATGTCTGATCAGAGCACACA
GGAGCAAATGAAGGGGGAGGAAGAGAGAGTGGAGCACATGCTGGCCCACCAAGCCCTGAG
GACAGTATTCCCACTCAGAGCAGCCAATGCACAGAGAGGACCATATGGCTGGCCCCACTA
CAAGACACGATGTCCCTCACTGACCCATAGTGCTTACGGGGACAACACTGGAGACACAGT
GTGGGAATTAGGCCAGATCTGACCCCACCACACTGAGGCAAAACACTAAGTGTGCAATAG
AACAGCAAGGGGAACAGGGCAACAAAGTCCCCAGGGAATACCAAAAATAGAATGTGGGTC
CAGGGCTTGGTGCTCCATGAGACTTGACTGGAAAACACTCCTAACGGTCAACAAACAGAC
CTTGAAATATCTACAAGCTTTTTTTGTCACCGGTTTTGTTGTCCATCCCTGGGGTGGACA
ACAGAAAAGTGGGTGAAGGGAAACATCGGCAGTATAAGACATGGAAAAATAATAATAATT
TATAAATTATTAAAGGTTCATGAAAGGAGGGAGGGGGAAAAATGTTGAGCTGATACCTAG
GGCCCAAGTAGAAAGAAAATGTTTTGAGAATGATGATGGCAAGAAATGTACAAATGTGCT
TGACACAATGGATGGATGGATGGATTGTGATAAGAGTTTTACGAGCCCCCAATAAAATTA
TTTATAAAAGTAATAATAATAAAAATTTTTAAATAAAATAAAAAATTTTCTGTTTAAACA
ACAACAAAAAAAGAAAGGGCCACATACAAGGAGCTTTAATGGGCTACTCTCACTGTTGGG
ATGAGATGGTCCATGCAACTCTGTCTTGTATGTTTTTCCCTTTGTGTGTTATACTCCACA
CATAAAAGAAAAAGAGAGGAAGAAGGCACATAATCTTGAAAACTCTCCAGCTTCTTTCCC
CATCGGATCTAAACACTGGTCTGAGTGGTTACAAAAGGAGAAAAAGTAACATTGACACTG
ACCTTATTGCTTTTGTAGCACATGGGTTCATTTCAAACAAATAAATACATAATATTTTAA
CAATTTCTTTGAGGCATTTAAGATGGAAATTCTTGTTATTAATGTTAGATGCCATTGAGT
GTGCTCCAGCTCTCAGCAGCCCTGCGTACAACAGAACTGAACCCTGGCTCTCCCTCCCCC
ATCCTCATAGCTGTTGTCATGTTTGAGCTCCTGGTTTCTGTCACTGTGCCAATCCATCTC
ACTGAGAATCTCTCCTGTTCTGCTGACCCATACATTACCAAGCAAGACGTCCTTTCCCTG
GTCCCTCTCGAGAACACATCCAAAGTACGTAAGATGAAGTCTCATCATGCGCTCTTCTAG
GGAGCATTCCCCTGTGCTTCTTACAAGACAGAACCCTTAACCAGCTGCATATTGTCCTTA
ATTAGAGGTGGCAGCCTAGTACTACTGTTGTTTTCTTATTATTATTAAAATCAGAGATTG
TGTCTTCTAGGATTAGGTAGGATTTTAATTATTAACTTTTTGAATTCCATTTTCCCTCTG
GAAAGGTTTAGTTTGTTGTTAATTCAATCTAATCATTTAATGTACATCTTTTTGTACATC
ATTGCTTATACATCATTCTCTTTCCTGAAATCTTTTCTGTGTGTTAATTTTTTTTTAAAG
TTCTTTTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTGTTAA
TTTTTTTTAAAGTTCTTTTCGATATTTCTTGGCAAAAAATACTTGTCTTAAATAAAGTAT
ATCTTAAAAATAATGATTTTATAAATAGAGTTTTAAATTTTATATTCTACTTACTTTTAT
AGTATGCAAATACCACAATTAAAGACAAAATATATAAAAAGAGAGAGAAAAAACCAGAAC
CCCTTTAGGAAGCAAGGGCCCAGAAAATATAAATTGTTTAAGAAAGAAGATTAAATAATC
TTTGTGATATGCTTCAAACTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved