Echinops_telfairi Locus Mono:427:SNORA42
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:427:SNORA42
Echinops_telfairi
Mono:427:SNORA42
scaffold_80082
SNORA42
1001..1135
2135
ATTCTAGGAGATTTTAACTGTCATCACAATCTCATAGTTGTTTCTTTTTAAATGTAAAA
CAAAGCTGGATTGATTCCACACAGTATACTGAACATGTGCAATTAATTCAGTGTTACAAT
TACATATCTATCTTCCAGGCTTTTCTAGTCAAAACATAAGTATGTAAAATTTAGTAGTAG
TGCTTTATTTGAATTTAAAATCAGAAACAGCCAGATTGTCTTAAGTGTTTTAGTGAAGGA
AATAAGAAGACAGGTTGCCTATCCTAGGACTAATTTTAATTTATGAAATTGATGTGACTT
ATGCCAAAACCTCAATGTAAATTAAGATTGTCAGATAATTTTTTGTATGAATTTTCTTTC
TGAAATCAGTTGCATTTATTTATTTATTTCCAATATATGGGGAGCTCTTACAGATATTAT
AATAATCCATAGTTCTTAGATCAAACATGATTGTACAATTATTGCCACCATAATTTTCAA
AGCATTTTCTTTATTTTTGCACTCTTTGGTATCCCCTTCATCCCCGCCCTCCCCCATCAC
TTGCATTTTAAATGACTTCAGAATGTCGTTTGAATATACTTCAAATTTTGAAAAATAGTA
TGCATAAACCTGCACATAAGGCAGTAAAAGAATCATTTGACATTACTATTTTCATGAAAG
GATATCTAATTTTCTCTTGAATAGATGTTATGAAGAATCTTTGTTTTGACTTTGTCTTTG
AATATTAGTCCTGGCCTAGATTTTCCTCCCGTTCTATGCCTAAAACTTAAGCCCCGTTTC
AAAAATAAATGGATGAATGAGTAGTAAGTGTGTCTTTCATCACAAATACATGAGATTCTA
TCAGATCCCAGAATAAGAATCCTTTAAAGTATTCTCTTAATGAATTCAAATAATTGGCTT
TCAGATAATTTAGACAGCTTTGTTAGTAATGGAATGTATGCTGGATAAACCTAGCTTCAA
ATTTCTTTATTCTTTTTCTAATCTATAAAATAGATTAATCTGCATGGGTTTGGATTTATG
GCAGGTCTGATCCCATGGGCCTCTCATCGTGTCCCATGCCAAAGCAAATTGTAACCCCGA
ACCATTGCCTGGCTTTACCCCCATGGACTTCAGGCACTGAAGTGGGTTACCCAGTGGGGG
GGGGGGGGGGGCGGGGGCGGGGAAAATTAAGATCCTGAACATAACATAAGAATAGGAATG
GATTAACCCCTATTATTTATTTAAATTCTTTAAGCATGGATTTGTAGACCAAAAAACCCA
TTGCTACCGAATCAATTCTGACTCATGGTGGTACATAAATACTTACTCTCTTTGCTACTA
TTCTCACTTCTGTAGTTCCTTGGGGCTTACTATTTGACCAAACATGAGGCTTTTCCCTTT
GGCTTCAGTATCATTCCATTTGTGTACAGCCAGTTCTTATTTTGAACTGTTTAAGAAAGC
AACAATTTTACTCTAGCTCTGGTAGGCAAACCTAATTTGTAGTAGGAATATAAAGGAGTA
CTTGCGTCACTACCTGTGGTTTTAGGTACAGATTTCAGAGAAATTAGTGCCTTTTCTTAT
TTCCTAGGAAAATTTCTTATTAATTTATTAAGAAACACCTACCAGAGAATTTTGGAAATA
TTTCCAGTTAAGAAAAAGCTTTATACAGATGGAAATTTCAGTAATACCCTTATACTCGAA
TTGTATTATCTGTATAGTGTCATTGTATTGGAACACTGATTTTCAGAATACTAAGCTATA
CCATTACAAGAATCAAAGTACTATATAAGACACAAACCTCTGAGAAAATGATAACTATAT
AGGTTTTGAAAAAAATACTTGCTTCATTTAACTGTTCATTGATTGCCCGCTTTTTATGTA
GACTAGAAATAAAGATTGTTATTTTATACAAATTATTTTTAACATTGCTATGGGTAATTT
GACCAGCTTGTAACATATTCACAGATGTTTTGAGAGAGAGATTCTTTCTCACACCTCTTC
AACCTTGAATGCTTCCATCGATAGACAGAAATAGTTACTTGGGGAAAACATCCTAATTGA
GAAATATTCTAGGCTAGAAAAAAATCATTTAATACCTTTAATAAAATTCACTATAAATAC
ATAAATAAAACAGCCACTTGATAAACCAAATGTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved