Echinops_telfairi Locus Mono:374:SNORD88
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:374:SNORD88
Echinops_telfairi
Mono:374:SNORD88
scaffold_263647
SNORD88
1001..1091
1658
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCCCTGGGTTTGTACCCAGCTCCTCAGTACGGATGGGGGGTGGGGGG
GCACCAGGTGGTACTACAGAGCTGGTAGAAGTATGTTGTCCCTTTCCCATCCTGTGATGC
CCTGTAATGTGGCATCTGCTCTGCAGACATGGGGTGGCAGGAGGCTGAGGGGATGGGAGA
GGAAGTAGTGGAGTCGATCTGGGTTCAACAGCTGCTGTGTCTGGCCCCCATGATGTCTAG
CACTGGGCTCCAATTGCCCCTGAGGACACTGTGCCCCCCAGGACCTTTGACACCTGGGGG
TCTGAGGGGCCATGGCTTAGGGAGGCTGCCTAGGGGAGGGATCGCTCTTGCCCCACCTGA
TCTAACACCTGTGTCCTTCCCCAGAAGATTTGGCAGCCATGGCTGACAGCATGCTGGTAT
CCTCCTATCTGGGCCGGGGCAACGAGAGCTATGCTTTCAGTGACCTCATGGACATGGCAC
GGCGCTTCCGGCAGCACACGGACACAGACAGACAGGAGCCCATGGTTACCTGGATCTTGC
GGGTGTATGACCAGGGGGGCCAGGTCCTGTACCTTGACCTCAGCAGAGCTGGCTACCCTG
GGGAACCTGACCAGTGACAGCCTCTTCAACTATTACCGGCGGACTTTGCAGGGCAGCTGC
CAGCCACTGCTCACCTGGCTGCTGAGAGCCTGGCGCCAGCGCTGGCCAACTCTCTCAGAC
TTCCGGGCCAGAGAGATGGACCTCCAGCCTTGGGCCACGCTGGAGGGGGGCATACAGCTA
GTGCGCGAGCTTGGCATGCTCAGCTGGATCTATCAGGACCCACCCTCTGCTCCATACCCT
GAGGACGTGGCCCTCACCCTTGACCTGCGGAGGCTCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved