Echinops_telfairi Locus Mono:350:SNORA17
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:350:SNORA17
Echinops_telfairi
Mono:350:SNORA17
scaffold_51293
SNORA17
1001..1131
1881
GGGCACTGTTTTCATTCTGTGGCACATAGAATCACTCGGCTTTGGAACCAACCTGATGA
CACCGAACAAAAGCAAAAACAGGCACATGCCTAGCTTAGAAAAGTATTATTACCCACTTA
AAACAATCAGCATGATCGATGCATAAAATGCATAAATGACATACAACAGTCATCCCTTTT
ATGAGTTATTTAGAAATGTATCTCTTATTTAACCACCTCCAAATGTTGATATGGACCAGC
TTCAGTCATTCCCCAAAGTTTCCTCTGTTCTTTTGTAGCCAATTTCTTCCATCAACACTG
GCCCCTGACCATCACTGTTCAAATAACTACTGCCCATAGTATAGTTTTATTTTTTGTAGA
ATGTTGTGCAAAATAAATAAATAAATAAAATAATACGATATGCAATATTTTGTATCTAGA
TTCTTTTTCTTAGCACAATGCTTTGGAAATGTGTCAATGCCTGTCCTAGCTTATCATTTT
TCACCAGTAAAGATGAAGAAGTTCAGTTGTATAAATGCACGATGTTGATTTATAACTTAC
CGTTGTTGCTACGAAGTGCTGTCAAGTCAGTTCTGACTCATAACAACCTTATGTATCCAT
TTACTGGAAAGTGTACGTATGTGTTATTTCCAATTTTTGTCTATGTTAAAGGTGCCAAGG
ATTTTTGTAAGCCAGAATTAATATGCAGTTTGATTTCTTTTGGTAATATACATGAGATAG
CTTCAAAAAGCTCATGAAAATATTTCATTATCTTTTAATTCCATTTGTTCATGAATTTTC
TAAAATCCCATATTACATGGTATTCACATGATTTGTGATTCATATGATATTCAAATGCAT
GTGATTTTATAAAGTGTGAAACTACTCTGTAAATTTTTATATCATGTTTTATAGGCCCAC
TAGTCATGTGTATTGTTAGTTTTCTTAATTTTTGCTGTTCTAGTGAATGTGTACGTGAGA
GTGGTTCTAAATTATATTTCTTAAAATATATAACAAAAGTTACTGCCCCTAGAGGCATTG
CAGCGTGGTCCACCCTGCCACAGCTGTGTCATTAGAGGGCAAAGAGAAGAGGGGCTATGT
CTAGGCTCAGGGGTCTGACGTGAACCACCTGACTGACTGCTAGCCCCACAGTCCTATTGC
ATCCTGTGTGACCTGGGGAACCTGAAGGGTGTGGGGGAGGCAGGTTCCCTGCTAACTCGT
TTTGCAAAGTGACAAGATCCTGGCAGCTGGATGACAGTGCAGGCCCTCAGCTGGTTAATT
TAATGCATGAAGGCAGGTGATGTCCCGTCGTGGGCACTGGCCACAGTCACTGACCACCAC
CATTCTGCCAAGACTCAGCCGCAGACCATGGTACAGACTGCAGGAGCCCCCTCCATGCCA
GGAGCACATCCCACTGTGACAGCCACAGACACTTCAGGGTGGTCGGGGGGCGCACAACAG
CCTCGGTGGGACACAGGCAGAGTTTGGCAGGTGTGGACTGAAGATGACCCCATGTCTGTC
CCACACGGCCGCCAGCTGAGGGGGCTGCTGGGAGGAGTGGTGAGGTCTGGCAGAAGCTCA
GTGGAGAAGGAATTCTTTCAAAATAAAGTGAACTGAAGGTGGTGTGTGGGGAAAAAATAT
ATAACAAAAGTTTATAAAATTTGCTATTCAAATATATTGTTCAATGACGTGTCTGCTTAT
ATATTTAAACTTAATAAAAATCATCTTTTTGAGTTGTCACGGTCTTGTATATGTTAAGGT
TACACGTATTTTGTTGTATTTTTAAATTTTGTGGAGTTTCTGTCTTGCTTTTACATTTCC
TTATCTTTTAAAATTCGAGTGTTTAATTTGTATCTTTTTTTTAGGATCCTTGCTTTTTGT
GTTCTACTTTAGATACAAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved