Echinops_telfairi Locus Mono:615:SNORA38
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:615:SNORA38
Echinops_telfairi
Mono:615:SNORA38
GeneScaffold_1159
SNORA38
1001..1126
2126
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTCCCTCCTGCGC
CTGCTGCGCTGCCCCCGTAGGACAGAAAGAGACAAGAAGTCAGTGCCAGTCCCCTCCGAA
GTAGGGTGACGTCTGCCTGGGTTTCCTGGGAGAACTTCGGTTTACGCTGTTGTTCTGAGG
TGGTCATTAGTAACACCCCTCTTTCCTTTCAAAAGTCTCAGTGATCACTTACCAAAATGC
TCCCCGGAGGCCCCATCCAATTAAGCAAAATGACACTGGAAACACAACACCAACTCCTGG
CTCCCTGTCTTTGGACACGTTAAGACTGGAAGGCCAAGACATGTGGACTTGGAGAAGTCT
GGCACCGGCTTGCTCCTCGCAGGCTCAAGCTCCCCCACGCCACATTGAAGGCACAGAAAA
GAAGAGAGAGAAAAGCCACTCCCGGTCCTGTGCCTGTCACAACAATCTGTCCCGATGGTC
ACTCAACACTCAGGAGCAAAGCCCTGCCCTTCCTCCAAAGGAGCCCCTGTGAGCTCAGGT
AGCCCCGAAATCCGCACGGACCCTCCATGTCAGAGCTTCCTTTATGGACCGGTCTGCGCT
GCCTGCTTTCGCCCCACTCTGACTCGTGCACGACAATAAGCTCAGGCCAGAGGAATCGGC
GAGCACAACAGCCTCCCAGCTGAGCGAGGGAGCATGGGGCGCGAGGCGGCAGAGACACAG
CAGCTGTTTGCCTCTCCACCAGAGAAGTGGCCCGAAAAGAGCAGGCACCAGCGCGCTCAT
CCCCCGAGGCTCCCATGTGACACCGGGAAGAGAGGAGCCACGGGCTGTGCGGGCGCAGAG
AGGAGAGAGCTCCCAGTTCACACGCAGACCTTCCCAAGGCACATCTCCGGGCTGTCCGAG
GAAAGGTTGGTCGGCTCAGGATGGTTGCACCCCGCCTGTCGGCACTCAGCACACAGGAAG
GACTCGTTCTAGAGTGGGGCTGATCTGAGTTCCACCAAGGGCTGGGATTCAAATCGAGGC
AGAGTTACGGGCTTGATGAGCTGTTTCCTTGAGACACTGCTTTGCATCTGCGAGGCCAGA
TGTGCTGTCAAGAAATTTAGACCCCCCAGATCTCCAGAGATGATTTGGGGAAAATAAAAA
CAAAAAGTAATTTGTGGGAGGAGGCTATAAGTAACCTTCAAAATGCAAACAGTTGTGTTC
CCTGCTGTGTTCACAACACAAACTCCCATTACATGTGCTTGAGGATGAGAACAAGCCTGA
CCTCTCTCTTTTCCACCAAGTGGTAGTAAAGTGAGGTAACCCATCTGGAATCAGCCANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved