Echinops_telfairi Locus Mono:516:SNORA4
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:516:SNORA4
Echinops_telfairi
Mono:516:SNORA4
GeneScaffold_7812
SNORA4
1001..1142
2142
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCCTTGAAAATTCAAATAACTGTATGAGTGATCTGTAAT
GTTTATATATCTATTTTTTAAATTGATTTCCTCATACAAAAAATAGTTTGTACAGCTTTA
CTATATAGACATATATAGTTTATTCTAGACTTGTTAATGTCTATTCAGATTTACATAACT
TACTTAATAAGCTCATTTGTATATTTTATTTTTTAAAGGGTGGATAAATATGCTATTTGA
TAATTATAAATAATATAGCATCAATCATAATAGCATATGGCAATATAAATGTTATATATT
ATAAATATTATTTGCATAGATTCTGCATATTGAAAACTTTTAGAAGATTTTTTCTCTAGC
ATGTCTCTATAATGAATAAATATAATACAATATTTCCAATTAGTCATCATAAAAACCAAA
TCCACTTCTTTTCTTTTGATTCCAACTCAAAATGACCTGTATAGGTGATTTCCAAAACAG
TAAATAGTTATGGGAACCCTCATCTTTATCATTCTCCAATCAAGTGACTTTTGAGTTTTA
ATTGCCAGTCTTGAGATTTGCAACCCACCACATCATCCACATCACCACCATGGCTCTTTT
TATTTTTGAGAAGAATTTATAATTTTGCAAAACTAAGTTTGTTACCAAAAGTTGATTTTT
GGAGGCAAGGGTTTTTTAATAACCTTTACCAGTTTGGGCTGTTTGGGAGAATAAAGAGAA
GACTGCATTCCACAGTGGGCTATACCACTTAGTACAGTTGGCTACTATTTTGTGGCCTAC
ATTTAAAAAAAAAACAAAGTTTTTAAACTATGTACAAGTTGTAAAAAGGTAGTAAGTAGT
AAAGGTTTCAAAACCTCTCTAAACACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAACGTGGTGAGAGTTTCCTCTCCTGACTGTAGGTTCCTGGGCCCGTCTCAC
ACCGCAGGGTCGGAGGCAGCGGTCTTAGTTGTCGCTGATGTGATTCCACTGCCCTGCAGT
GTGGGCAACCACTGAGCCAAACTGCGACTCAAGAAGGTGATGAGAGCGTGTGTTCCGTGT
GCTCACGCTCTGCTGGTGGTGACAGTCCGTTTGTGCGACACATGACCAGGAAGGCCCTCA
CACCACCTACGGTCTCCCCGGTCCCCAGCTCTTGTAGAAAACAACAGGAGAGCTCCCACA
CACTGCCTACACCCTCGGAGAGGGCTCCGGCACTTCCTTCCCATGAGCACAACGTGCCTC
CTGAGGCAACAGTCAGAACCACCTGTCATGAACGCAGCGCCCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved