Echinops_telfairi Locus Mono:80:SNORA61
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:80:SNORA61
Echinops_telfairi
Mono:80:SNORA61
scaffold_265946
SNORA61
1001..1125
2047
CAGTTGTTTTCATCTAGTGGGTAACCAACATCGCGTTCCCATTTTCGAGTATGTTGATG
CAGAACTTCTTTGGCGCTGCCTGTAGACAGTTGTATAACTTAACAATACTGCTCGAGCCC
TTACCCCCTTGAAATATTGAGCCTTCTCAAGTTCCAAGGAAGCCTGTGGTGACTGCACAA
CATTCTGATGTTAAAACACCTTGTTTGGAAAATATTCAGATGGTGATTTTCAACTACGTA
TTTGATCAGGGTAGATTTCCTAAAGATAATGAGAGTGGAATCTTGAAAACCCCAAATAAA
AGAAACCCACCCGACCCACCCCAGCCCTTTATCTAATATGCTCATTCACAATGCAGATCT
TTTCTGTACCCCTGAAGCAAGATTGCCCTGCTTCTCATAAGATTTCATGAGTCTCACTCT
ACTCTGTCTTTTTCAAGAAAGGAGAGTCCAGAGTGATGTAGCTATGGTTTTGTTGCCATC
TCAGGAAGGGTTCATTTTACAAATAAGAATCATTTTAGGAATAAGAAAGAAAACAATTTG
GCATTACACAAATGTGTTAAGACTTATTCATTCACTCGATGAATATTTATCAAGCTTCCA
CTGGATGCCAAGCGCTATGTTAGGTCCAGGGTATTGGTAGCAGTAAGCAAAATAGATAAA
GTTTTTACTCAGGAGATTGCTTTTGGATGAGATTCCTAACAGACAGATACCTTTATAAAT
ATGAATCGAATATATCTGCTTCAATATTCGTTCGATAATTTATGGTCTAGCTCTTAAGCA
ATAAAATGGTTGAATACCATCCTGGTTAGCAATGTTTCAAAGAAAACCTGACCAGCCTAG
TTTAAACCCTCCTTGCCTCTTGTTATGATGATCACGCTATCCTTCTAATTGTTTCTATTC
TCTCCAGGTCAACTGTCAGAACTAGATTTCATTCTTATACTTGTAGAATTAAAATATGTA
TCAAGATGATAAACTAAGAAAGGTCACAGCCTTAAAAAAAAACCCTCTAGATCCCTTATC
CATCAGACCTAAACACTGGTCTGCGTGGTTATAAAAGGAGGAAAAGTAAAATTGAAACAA
AGTTAAATTCTTTTGTGACACACCAGCTAGCTTTCAACAAACAAAAGCAATACATTACTA
TTATTAGAAACCAAGAATTCCCTCCAAAAAATCTTATCATGACAAACAACCACTGTTTAC
TGTGTAGTCTAGTAATATACTATGATGGTTTTTCCTTCTCTACAATGTACTTTTCTTGGA
ATTTCTAACTGCCAGTTGTTTTGCTTTGTTTGCTCAGACCTTATCTAGCATCCACCTGTC
TCCTCAATTCTTTATTACTTCTCCGTAGTGTTAGACACTATATCAAATCCCCTCGTATCT
CATAGGTCACCTTCCCAGAGTCTACCATCTCCCTAATCCAACGTTCTTCTGCGGACCTGC
TGCACAAATGTCACCCTGAGCTGTCTGCATGCCACTCTCCCAGATTGGATGCAATTTCCT
GAAGCCCAACCTTGTTTCACATGCTGAGGTTGTCAGAGCACAGTCTTCAGTAGCTCTTCA
AGAAAAAAAATCGCACGAGAGAGAAAAGGTCTGATCCCTTGCTTGTCTGAAAAGGTCTTT
AGCCTCTCATTTAATTCATATTTTAACTGGGAAGTCTGACTTGAAATTTTCTCTCTTGCA
TTTTGTATGGCCTCAATCAGTAATCTTCTAGTATCTATTACTGGGCTTGAGAGCCTGCTA
TTGTTTGGATCCCTCTTTGTACATTATGTGTGAGTGACCTTCTGGAAACTTTTAGAACAT
CTCTGAATCTCTGCTGTTCTGACATTTCAGCATTAGATGTGCCTGGCACCTATCTTGAGA
TCATAAGCCTCTTGGGTTCACTTTCTCCTCTAACTTGAGGAGGCACTGGGTAGTTGGCAG
TGTGACACAGGGTGGGAGTGGGGTGAAGGGAGGGTAGGGGGGAGAGACACTCATTTAAAG
CACAGCTCTGATGCCGTAACCCCCGATTAAAAGCCTTCAGGAAAGTTCAAACTCCCCAGT
GTGGTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved